Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10849

Sec11a SEC11 homolog A (S. cerevisiae) ( MGI:1929464)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10849 EMAGE:10849 EMAGE:10849 EMAGE:10849 EMAGE:10849
"Pseudo-wholemount" of euxassay_003417. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_003417_01 euxassay_003417_02 euxassay_003417_03 euxassay_003417_04
EMAGE:10849 EMAGE:10849 EMAGE:10849 EMAGE:10849 EMAGE:10849
euxassay_003417_05 euxassay_003417_06 euxassay_003417_07 euxassay_003417_08 euxassay_003417_09
EMAGE:10849 EMAGE:10849 EMAGE:10849 EMAGE:10849 EMAGE:10849
euxassay_003417_10 euxassay_003417_11 euxassay_003417_12 euxassay_003417_13 euxassay_003417_14
EMAGE:10849 EMAGE:10849 EMAGE:10849 EMAGE:10849 EMAGE:10849
euxassay_003417_15 euxassay_003417_16 euxassay_003417_17 euxassay_003417_18 euxassay_003417_19
EMAGE:10849 EMAGE:10849 EMAGE:10849 EMAGE:10849
euxassay_003417_20 euxassay_003417_21 euxassay_003417_22 euxassay_003417_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10849Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10849_wholemount_strong.wlz
10849_wholemount_moderate.wlz
10849_wholemount_weak.wlz
10849_wholemount_possible.wlz
10849_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10849_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 17 18 19 20 21
pancreas
moderate moderate
regionalmoderate expression: see section 11 12 13 14 18
vibrissa
moderate moderate
regionalmoderate expression: see section 06 07 08 09 21 22 23
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 16 17
pons mantle layer
moderate moderate
regionalmoderate expression: see section 08 18
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 07 08 19 20
trigeminal v ganglion
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 17 18 19 20 21 22
vagus x ganglion
weak weak
regionalweak expression: see section 09 19
ventral grey horn
moderate moderate
regionalmoderate expression: see section 11 12 14 17 weak expression: see section 13 15 16 18
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 11 18
cervical ganglion
weak weak
regionalweak expression: see section 10 18
thoracic ganglion
weak weak
regionalweak expression: see section 15 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 13 14 15 18 19 20 weak expression: see section 10 11 12
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 16 17 18 19 20
nasal cavity respiratory epithelium
moderate moderate
regionalmoderate expression: see section 13 14 17 18
meckel's cartilage
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 12 13 19 20 21 22 23
lower jaw incisor
weak weak
regionalweak expression: see section 12 13 14 15 17 18 19
upper jaw incisor
weak weak
regionalweak expression: see section 12 13 14 17 18 19
kidney calyx
moderate moderate
regionalmoderate expression: see section 22 weak expression: see section 10 11 12 13 20 21
testis
moderate moderate
regionalmoderate expression: see section 07 08 09 10 22 23
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 01 02
not examined not examined
regionalnot examined expression: see section 22
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 20 21 22 23
clavicle
moderate moderate
regionalmoderate expression: see section 10 11 12 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T5937
Entity Detected:Sec11a, SEC11 homolog A (S. cerevisiae) ( MGI:1929464)
Sequence:sense strand is shown

>T5937
CGGACGCGTGGGGGCCCGTGTTGCAGCGGTCCCTCTTGGTGGTTCTATCGCGCCCTCTTGGCTGCTAGTT
GTCGCGCTCTCCATCTCACCATGCTGTCTCTAGACTTTCTAGACGATGTGCGGCGGATGAACAAGAGGCA
GCTGTACTACCAAGTCCTAAATTTTGGAATGATTGTCTCCTCGGCACTAATGATCTGGAAGGGGCTGATG
GTGATAACCGGAAGTGAGAGTCCAATTGTAGTGGTGCTCAGTGGCAGCATGGAGCCTGCGTTTCACAGAG
GGGATCTCCTTTTCCTCACGAACCGAGTTGAAGATCCTATACGCGTGGGGGAGATCGTTGTTTTCAGGAT
AGAAGGAAGAGAGATTCCTATAGTGCACCGAGTCCTGAAGATCCATGAAAAGCAAGATGGGCATATCAAG
TTTTTAACCAAAGGAGATAATAATGCTGTTGATGACCGAGGTCTCTATAAACAAGGACAACACTGGCTGG
AGAAGAAAGATGTTGTGGGGAGAGCAAGAGGGTTTGTTCCTTACATTGGAATTGTGACGATCCTCATGAA
TGACTATCCTAAATTTAAGTATGCAGTACTGTTTCTGCTCGGTTTATTTGTGCTGGTCCATCGTGAGTAA
GAAGTCGGACTCCCTGTTCCTAGGAAGCTGCTGTGCTTGTTGTTACTGAATGTTGGAGTAGATCCTGATC
TGTGATTGCGGATTTTCGGAGGACACACACGTTGGCACTTCTTGGTAGCCCTGGTTTGCATTGCTTTGTG
TTTCCACACCCGAGGCTGTGTGGGCGGGTGCATGTGCACCGTGGAGTGCACACAAGGGGACTGTCAATCA
CAGGGTTTCATATGTTGTCATTGTCACTCTTTCACATTTTTGTACATCAGTGAATTTTTTATATTAAAAG
GTTGAGCCAAAAAAAAAAAAAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:3483051 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:3483051 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10851 same embryo
 EMAGE:10846 same embryo
 EMAGE:10848 same embryo
 EMAGE:10850 same embryo
 EMAGE:10847 same embryo
 EurExpress:euxassay_003417 same experiment
 MGI:4827929 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS