Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11031

Tceb1 transcription elongation factor B (SIII), polypeptide 1 ( MGI:1915173)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11031 EMAGE:11031 EMAGE:11031 EMAGE:11031 EMAGE:11031
"Pseudo-wholemount" of euxassay_003419. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_003419_01 euxassay_003419_02 euxassay_003419_03 euxassay_003419_04
EMAGE:11031 EMAGE:11031 EMAGE:11031 EMAGE:11031 EMAGE:11031
euxassay_003419_05 euxassay_003419_06 euxassay_003419_07 euxassay_003419_08 euxassay_003419_09
EMAGE:11031 EMAGE:11031 EMAGE:11031 EMAGE:11031 EMAGE:11031
euxassay_003419_10 euxassay_003419_11 euxassay_003419_12 euxassay_003419_13 euxassay_003419_14
EMAGE:11031 EMAGE:11031 EMAGE:11031 EMAGE:11031 EMAGE:11031
euxassay_003419_15 euxassay_003419_16 euxassay_003419_17 euxassay_003419_18 euxassay_003419_19
EMAGE:11031 EMAGE:11031 EMAGE:11031 EMAGE:11031 EMAGE:11031
euxassay_003419_20 euxassay_003419_21 euxassay_003419_22 euxassay_003419_23 euxassay_003419_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11031Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11031_wholemount_strong.wlz
11031_wholemount_moderate.wlz
11031_wholemount_weak.wlz
11031_wholemount_possible.wlz
11031_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11031_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22 23 24
gland
strong strong
regionalstrong expression: see section 19
adrenal gland
moderate moderate
regionalmoderate expression: see section 08 09 10 17 18 19
thymus primordium
moderate moderate
regionalmoderate expression: see section 11 12 13
submandibular gland primordium
strong strong
regionalstrong expression: see section 06 07 08 09 16 17 18 19 not examined expression: see section 14 15
pancreas
moderate moderate
regionalmoderate expression: see section 09 10 11 12
vibrissa
moderate moderate
regionalmoderate expression: see section 04 05 06 07 19 20 21 22
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 15 16
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 20 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 18 19
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 17 18 19 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08 16 17
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 17 18
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10 16
cervical ganglion
moderate moderate
regionalmoderate expression: see section 09 10 17
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 12 13 14
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 16 17 18
naris
moderate moderate
regionalmoderate expression: see section 11 12 17
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 15 16 17 18 19
nasal cavity respiratory epithelium
moderate moderate
regionalmoderate expression: see section 11 12 13 15 16 17
tongue
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18
midgut
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18 19 20 21 not detected expression: see section 23 not examined expression: see section 22
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 12 15 16
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 08 09 18 19
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 15 16
upper jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 08 09 18 19
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 16 17 18 19 20 21 22 23 24
not examined not examined
regionalnot examined expression: see section 15
bladder
moderate moderate
regionalmoderate expression: see section 13 14 15
metanephros
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 17 18 19 20
lung
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 21 22 23 24
not examined not examined
regionalnot examined expression: see section 07 08 09 10 11 12 13 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T5942
Entity Detected:Tceb1, transcription elongation factor B (SIII), polypeptide 1 ( MGI:1915173)
Sequence:sense strand is shown

>T5942
GGCGGTACGTGGGGTTACGGCTGCGGTAGCTGCGGGACTGGCTAGAAAATACTAAAGTTCCTCTGGGCTC
AGATAGAATTTTATCAGAACATAATGGATGGAGAGGAGAAGACCTATGGTGGCTGTGAAGGCCCTGATGC
TATGTATGTGAAATTAATATCTTCTGATGGCCATGAATTTATTGTAAAAAGAGAACATGCACTAACATCA
GGAACAATAAAGGCTATGTTGAGTGGTCCAGGTCAGTTTGCTGAGAATGAAACCAACGAGGTCAATTTTA
GAGAGATCCCCTCACATGTGCTATCAAAAGTGTGCATGTATTTTACCTACAAGGTCCGCTATACTAACAG
CTCCACTGAAATTCCTGAATTCCCAATTGCACCTGAAATTGCACTGGAACTGCTGATGGCTGCAAACTTC
CTAGATTGTTAAATAAAATAAATTATAATAAACTGTTAATTTTTTTCAGTATTTAATACCTGTAGTTCAG
TTAGTAATTTTTTCACATATAGCATGTTGCCTGTATGAAATTGAGCTGTAAAGCTAATTGCCGAGCAGAT
TCCTTCTGTCATTTGCATAGCAGAGTTGAAATTTGTTTGCTACATCAACAAATTAAGGACATTTCACAAG
TCAAAAAATAAATAAATAATGCCAGTTTATAGATGGTTTGCTTTCTCCTGGATATGACCTTTAAAATTAT
AACTGATAGAGCAAATCCTGGAATATAAACGTAAATGAATATATTCTACAGGTAAATACAGGGGCTTTTT
ATGTTTCTAGTGTTTTTTTAAGAACCAGTTCTGATCTTATGCCACTGAGCATTACTAGAGTTATGCAAAT
AATTACATGGAAAACATGTTTATAACTTAGCCAAACCTTGATTTTTGTAACTCAAAGAATAAGAGTTGAA
ATTTCTTATGTGTTTTTTTATAAACTGCAGTATTGTTTAAGTGCAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:3483215 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:3483215 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11030 same embryo
 EMAGE:11032 same embryo
 EMAGE:11034 same embryo
 EMAGE:11033 same embryo
 EMAGE:11029 same embryo
 EurExpress:euxassay_003419 same experiment
 MGI:4828633 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS