Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11246

Uqcrh ubiquinol-cytochrome c reductase hinge protein ( MGI:1913826)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11246 EMAGE:11246 EMAGE:11246 EMAGE:11246 EMAGE:11246
"Pseudo-wholemount" of euxassay_006525. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006525_01 euxassay_006525_02 euxassay_006525_03 euxassay_006525_04
EMAGE:11246 EMAGE:11246 EMAGE:11246 EMAGE:11246 EMAGE:11246
euxassay_006525_05 euxassay_006525_06 euxassay_006525_07 euxassay_006525_08 euxassay_006525_09
EMAGE:11246 EMAGE:11246 EMAGE:11246 EMAGE:11246 EMAGE:11246
euxassay_006525_10 euxassay_006525_11 euxassay_006525_12 euxassay_006525_13 euxassay_006525_14
EMAGE:11246 EMAGE:11246 EMAGE:11246 EMAGE:11246 EMAGE:11246
euxassay_006525_15 euxassay_006525_16 euxassay_006525_17 euxassay_006525_18 euxassay_006525_19
EMAGE:11246 EMAGE:11246 EMAGE:11246 EMAGE:11246 EMAGE:11246
euxassay_006525_20 euxassay_006525_21 euxassay_006525_22 euxassay_006525_23 euxassay_006525_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11246Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11246_wholemount_strong.wlz
11246_wholemount_moderate.wlz
11246_wholemount_weak.wlz
11246_wholemount_possible.wlz
11246_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11246_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
strong strong
regionalstrong expression: see section 01 02 03 04 20 21 22 24
upper leg muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 20 21 22 23 24
hand
strong strong
regionalstrong expression: see section 01 02 23 24
foot
strong strong
regionalstrong expression: see section 02 03 04 05 06 18 19 20 21
lower leg rest of mesenchyme
strong strong
regionalstrong expression: see section 01 24
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
thymus primordium
strong strong
regionalstrong expression: see section 11 12 13 14 15
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 08 09 15 16 17 18 19
pancreas
strong strong
regionalstrong expression: see section 09 10 11 12 16 17
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
integumental system
strong strong
regionalstrong expression: see section 10
skin
strong strong
regionalstrong expression: see section 02
epidermis
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vibrissa
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 18 19 20 21 22 23
spinal cord
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18
inner ear
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 16 17 18 19 20
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 18 19 20 21 22 23 24
retina
moderate moderate
regionalmoderate expression: see section 01 02 03 22 23 24
anterior naris
strong strong
regionalstrong expression: see section 10 11 12 14 15 16
external naris
strong strong
regionalstrong expression: see section 10 11 15
posterior naris
strong strong
regionalstrong expression: see section 11 12 15
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 14 15 16 17 18 19
naso-lacrimal duct
strong strong
regionalstrong expression: see section 02 03 04 05 07 08 17 18 19 20 21 22 23 24
esophagus epithelium
strong strong
regionalstrong expression: see section 12 13
pharynx epithelium
strong strong
regionalstrong expression: see section 11 12 13 14
tongue epithelium
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16
tongue muscle
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14
stomach
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10
rectum
strong strong
regionalstrong expression: see section 14
midgut
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
lower jaw incisor
strong strong
regionalstrong expression: see section 09 10 11 12 14 15 16
lower jaw molar
strong strong
regionalstrong expression: see section 18 19
upper jaw incisor
strong strong
regionalstrong expression: see section 10 11 12 15 16
upper jaw molar
strong strong
regionalstrong expression: see section 19
liver
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
urinary system
strong strong
regionalstrong expression: see section 05 06 07 08 21 22 23
bladder
strong strong
regionalstrong expression: see section 12 13 14 15
metanephros
strong strong
regionalstrong expression: see section 08 12 17
renal cortex
strong strong
regionalstrong expression: see section 09 10 11 18 19 20 21 22
urethra of male
strong strong
regionalstrong expression: see section 13 14
left lung
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12
right lung
strong strong
regionalstrong expression: see section 13 14 15 16 17 18 19 20 21 22 23 24
trachea
strong strong
regionalstrong expression: see section 12 13 14
tail paraxial mesenchyme
strong strong
regionalstrong expression: see section 11 12 13 moderate expression: see section 14 15 16 17
axial skeleton tail region
strong strong
regionalstrong expression: see section 11 12 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T6620
Entity Detected:Uqcrh, ubiquinol-cytochrome c reductase hinge protein ( MGI:1913826)
Sequence:sense strand is shown

>T6620
GTACTACTCTGGTTGCGCTTGTTGGATCCCAAACCGGCTCCCGACATGGGACTAGAGGACGAACGAAAGA
TGCTCACTGGATCTGGAGACCCCAAAGAGGAAGAAGAGGAAGAACTAGTGGACCCCCTAACAACAGTGAG
AGAGCACTGTGAACAGCTGGAGAAGTGTGTAAAGGCCCGGGAACGACTAGAGTTGTGTGATAATCGCGTG
TCTTCTCGGTCACAGACAGAAGAGGATTGTACAGAGGAGCTCTTTGACTTCTTGCATGCACGGGACCACT
GTGTGGCCCACAAGCTCTTTAAAAACTTGAAGTAAATGTGCAGATTCGTCCTCCTCAGCCTTGTCACTGG
GAATCAGGAACAGTTCCTTGTGGTTCTGGACGTCGGTGTCTGATGGAGTGAGTTCTCGAGAACCTCACTG
ACTTTGGCGGTAGCTTCTCTTCTGTGTGACTAGCAGTGACTTCATCTTAATAAACTGATCTGCAAACTTA
AAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:3597862 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:3597862 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11248 same embryo
 EMAGE:11247 same embryo
 EurExpress:euxassay_006525 same experiment
 MGI:4829117 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS