Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11364

Bhlhe41 basic helix-loop-helix family, member e41 ( MGI:1930704)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11364 EMAGE:11364 EMAGE:11364 EMAGE:11364 EMAGE:11364
"Pseudo-wholemount" of euxassay_019485. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019485_01 euxassay_019485_02 euxassay_019485_03 euxassay_019485_04
EMAGE:11364 EMAGE:11364 EMAGE:11364 EMAGE:11364 EMAGE:11364
euxassay_019485_05 euxassay_019485_06 euxassay_019485_07 euxassay_019485_08 euxassay_019485_09
EMAGE:11364 EMAGE:11364 EMAGE:11364 EMAGE:11364 EMAGE:11364
euxassay_019485_10 euxassay_019485_11 euxassay_019485_12 euxassay_019485_13 euxassay_019485_14
EMAGE:11364 EMAGE:11364 EMAGE:11364 EMAGE:11364 EMAGE:11364
euxassay_019485_15 euxassay_019485_16 euxassay_019485_17 euxassay_019485_18 euxassay_019485_19
EMAGE:11364 EMAGE:11364 EMAGE:11364 EMAGE:11364 EMAGE:11364
euxassay_019485_20 euxassay_019485_21 euxassay_019485_22 euxassay_019485_23 euxassay_019485_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11364Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11364_wholemount_strong.wlz
11364_wholemount_moderate.wlz
11364_wholemount_weak.wlz
11364_wholemount_possible.wlz
11364_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11364_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
adrenal gland
weak weak
regionalweak expression: see section 09 10 18 19
vibrissa
weak weak
regionalweak expression: see section 09
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 13 14
palatal shelf
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55013
Entity Detected:Bhlhe41, basic helix-loop-helix family, member e41 ( MGI:1930704)
Sequence:sense strand is shown

>T55013
CATGGACGAAGGAATCCCTCATTTGCAAGAGAGACAGTTACTGGAACATAGGGATTTTATAGGACTGGAC
TATTCCTCTTTGTATATGTGTAAACCCAAAAGGAGCTTGAAGCGAGACGATACCAAGGATACCTACAAGT
TACCGCACAGATTAATAGAAAAGAAGAGACGAGACCGAATTAATGAATGCATTGCTCAGCTGAAAGATTT
ACTGCCCGAACATCTGAAATTGACAACACTGGGGCATTTGGAGAAAGCAGTAGTCTTGGAATTAACTTTA
AAGCACTTGAAAGCGCTAACAGCCTTAACTGAGCAGCAGCATCAGAAGATAAT
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:unspecified; Reverse Primer - name:unspecified, sequence:unspecified. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4823468 same experiment
 EurExpress:euxassay_019485 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS