Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11398

Nav2 neuron navigator 2 ( MGI:2183691)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11398 EMAGE:11398 EMAGE:11398 EMAGE:11398 EMAGE:11398
"Pseudo-wholemount" of euxassay_008549. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008549_01 euxassay_008549_02 euxassay_008549_03 euxassay_008549_04
EMAGE:11398 EMAGE:11398 EMAGE:11398 EMAGE:11398 EMAGE:11398
euxassay_008549_05 euxassay_008549_06 euxassay_008549_07 euxassay_008549_08 euxassay_008549_09
EMAGE:11398 EMAGE:11398 EMAGE:11398 EMAGE:11398 EMAGE:11398
euxassay_008549_10 euxassay_008549_11 euxassay_008549_12 euxassay_008549_13 euxassay_008549_14
EMAGE:11398 EMAGE:11398 EMAGE:11398 EMAGE:11398 EMAGE:11398
euxassay_008549_15 euxassay_008549_16 euxassay_008549_17 euxassay_008549_18 euxassay_008549_19
EMAGE:11398 EMAGE:11398 EMAGE:11398 EMAGE:11398
euxassay_008549_20 euxassay_008549_21 euxassay_008549_22 euxassay_008549_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11398Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11398_wholemount_strong.wlz
11398_wholemount_moderate.wlz
11398_wholemount_weak.wlz
11398_wholemount_possible.wlz
11398_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11398_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 04 05 06 07 08 09 10 17 18 19 20 21 22 23 weak expression: see section 03 11 12 13 14 16
thymus primordium
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16
submandibular gland primordium
strong strong
regionalstrong expression: see section 08 09 19 20 moderate expression: see section 07 10 18
vibrissa
moderate moderate
regionalmoderate expression: see section 04 05 06 07 21 22 23 weak expression: see section 08
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 16 17 18 21 22 23 weak expression: see section 02 03 04 15 19 20
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 10 16 17 weak expression: see section 11 12 15
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 04 05 06 20 21 22 23 weak expression: see section 07 08 09 10 11 14 15 16 17 18 19
midbrain mantle layer
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15 16 17 18
ventral grey horn
moderate moderate
regionalmoderate expression: see section 12 13 17 weak expression: see section 14 16
neural retina
moderate moderate
regionalmoderate expression: see section 02 03 weak expression: see section 01 23
tongue muscle
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 weak expression: see section 11
lower jaw incisor
weak weak
regionalweak expression: see section 11 16 17
lower jaw molar
strong strong
regionalstrong expression: see section 07 08 20
upper jaw incisor
weak weak
regionalweak expression: see section 11 16 17
upper jaw molar
strong strong
regionalstrong expression: see section 07 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35709
Entity Detected:Nav2, neuron navigator 2 ( MGI:2183691)
Sequence:sense strand is shown

>T35709
TACCAATAAGAAGAGCTCCCCAAAGGGTAATGAGAAAGAGAAGGAGAAGCAGCAGCGGGAGAAGGAGAAG
GAGAAAGAGAAGGAGAAGGGCAAGGACCTCACCAAGAGAGTCTCCGTGACCGACAGGCCTGACCTCAAGG
AAGAAACCAAGGCAGATCTCAGTGGGGTGGCTGTGACTGAGATGCCGAAAAAGTCCTCCAAGATCGCCAG
CTTTATCCCCAAAGGGGGCAAGCTCAACAGCACCAAGAAGGAGGCTACAGCTCCGTCCCACAGCGGCATA
CCAAAACCAGGAATGAAGAACGTGTCTGCGAAGTCCCCAAGTGCCCCCATACCTCCCAAGGAAGGAGAGA
GGAGCAGAGGGAAGCTGAGCTCAGGGCTCCCTCCCCAGAAGGCCCAGCTGGACAGCAGGCACTCTAGCTC
CTCCTCCAGCCTGGCATCCTCGGAGGGAAAAGGCCCCGGAGGGACCAGTCTAAACCCCAGCATCAGCAGC
CAGACCGTCAGCGGCTCCGTCGGGACCACGCAGACCACTGGAAGCAATACCGTCAGTGTCCAGCTACCTC
AGCCTCAGCAGCAATACAACCATCCCAACACAGCCACGGTTGCACCTTTTCTGTACAGGTAAGCAGCACC
CGCTACCCCTGGGGAAAGAGCCTAACTGCTGGCTCTGTCCGTGCGGGGATCAGGAACATGTGAGCCAACA
GCTAAAGCAATACATAGTTCTAGCCTGGGGCACTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 68422. Forward Primer - name:068422_F_cDNA_5330421F07Rik, sequence:TACCAATAAGAAGAGCTCCCCA; Reverse Primer - name:068422_N_SP6_cDNA_5330421F07Rik, sequence:GAGTGCCCCAGGCTAGAACTAT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11397 same embryo
 EMAGE:11399 same embryo
 EMAGE:11400 same embryo
 EurExpress:euxassay_008549 same experiment
 MGI:4826605 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS