Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11483

Mitf microphthalmia-associated transcription factor ( MGI:104554)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11483 EMAGE:11483 EMAGE:11483 EMAGE:11483 EMAGE:11483
"Pseudo-wholemount" of euxassay_019482. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019482_01 euxassay_019482_02 euxassay_019482_03 euxassay_019482_04
EMAGE:11483 EMAGE:11483 EMAGE:11483 EMAGE:11483 EMAGE:11483
euxassay_019482_05 euxassay_019482_06 euxassay_019482_07 euxassay_019482_08 euxassay_019482_09
EMAGE:11483 EMAGE:11483 EMAGE:11483 EMAGE:11483 EMAGE:11483
euxassay_019482_10 euxassay_019482_11 euxassay_019482_12 euxassay_019482_13 euxassay_019482_14
EMAGE:11483 EMAGE:11483 EMAGE:11483 EMAGE:11483 EMAGE:11483
euxassay_019482_15 euxassay_019482_16 euxassay_019482_17 euxassay_019482_18 euxassay_019482_19
EMAGE:11483 EMAGE:11483 EMAGE:11483 EMAGE:11483 EMAGE:11483
euxassay_019482_20 euxassay_019482_21 euxassay_019482_22 euxassay_019482_23 euxassay_019482_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11483Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11483_wholemount_strong.wlz
11483_wholemount_moderate.wlz
11483_wholemount_weak.wlz
11483_wholemount_possible.wlz
11483_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11483_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 17 18 19 weak expression: see section 14 15 16
vibrissa
weak weak
regionalweak expression: see section 05 06 07 08 09 21 22 23 24
telencephalon
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 17 18 19 20 21 22 23 24 weak expression: see section 14 15 16
hindbrain
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 17 18 19 20 21 22 weak expression: see section 14 15 16
midbrain
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 17 18 19 weak expression: see section 14 15 16
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 weak expression: see section 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08 19 weak expression: see section 20
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 18 19 20 weak expression: see section 21 22 23
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 18
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 07 08 18 19 weak expression: see section 20
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 10 weak expression: see section 18
spinal cord
moderate moderate
regionalmoderate expression: see section 10 11 12 13 17 18 weak expression: see section 14 15 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 10 11 13 17 18 19 weak expression: see section 12
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 04 weak expression: see section 24
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 11 12 13 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55106
Entity Detected:Mitf, microphthalmia-associated transcription factor ( MGI:104554)
Sequence:sense strand is shown

>T55106
AACCGACAGAAGAAGCTGGAGCATGCGAACCGGCACCTGCTGCTCAGAGTACAGGAGCTGGAGATGCAGG
CTAGAGCGCATGGACTTTCCCTTATCCCATCCACCGGTCTCTGCTCGCCTGATCTGGTGAATCGGATCAT
CAAGCAAGAACCAGTTCTTGAGAACTGCAGCCAGGAACTTGTACAGCACCAGGCAGACCTGACATGTACG
ACAACTCTGGATCTCACGGACGGTACCATCACCTTTACCAACAACCTCGGCACCATGCCGGAGAGCAGCC
CGGCCTACAGCATCCCCAGGAAGATGGGCTCCAACTTGGAAGACATCCTGATGGACGATGCCCTCTCACC
TGTTGGAGTCACCGACCCACTGCTGTCATCAGTGTCGCCAGGAGCTTCAAAAACAAGCAGCCGGAGGAGC
AGTATGAGCGCAGAAGAAACGGAGCATGCGTGTTAGCGAGCCTGCCTTGCTCTGCCTCTGCACGGACCGC
TCCCTCTCTTCTTCAGGAGACTTTATAATTTACCTGAAGAGGTTTTCTTGATAATTTTCCTTTAATATGA
AATTTTCGTGCTTTATCAGTAGCCCTGCATATATTTTATTTTTAGAATTTTGTGAGCCAGACTTGTATAT
TCTATTTTACAACTACAAAGGCCTCCTAAGTATTGTACCTTCAGCGTGCAGTATCTGTGAACTGATTTCT
CCAAGTGTGAGCTTTCTGAGCAAGGGGATTTTTTTGCTTCAGAGAAGTAAGTGTCTGTCCGTTTTCATTC
AGGGGAAAACTTGGTGTGAGCTTTGTCTGTCTGTGACCTCCTTTGAAATTAACATGTAAAGTTTAATTAC
ACGAATGTAAAGCAACCAAAAGAAGAAAACAAAGAAGATGATGATTATGATAGAAGAAGGAGAAGAGGAG
GAAGAGGAAGAGGAGGAGGAAGAGGAGGAAGAAAGATGGTGGGAAAGACATCCAA
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:AACCGACAGAAGAAGCTGGA; Reverse Primer - name:unspecified, sequence:TTGGATGTCTTTCCCACCAT. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4826385 same experiment
 EurExpress:euxassay_019482 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS