Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11545

Stxbp6 syntaxin binding protein 6 (amisyn) ( MGI:2384963)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11545 EMAGE:11545 EMAGE:11545 EMAGE:11545 EMAGE:11545
"Pseudo-wholemount" of euxassay_006760. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006760_01 euxassay_006760_02 euxassay_006760_03 euxassay_006760_04
EMAGE:11545 EMAGE:11545 EMAGE:11545 EMAGE:11545 EMAGE:11545
euxassay_006760_05 euxassay_006760_06 euxassay_006760_07 euxassay_006760_08 euxassay_006760_09
EMAGE:11545 EMAGE:11545 EMAGE:11545 EMAGE:11545 EMAGE:11545
euxassay_006760_10 euxassay_006760_11 euxassay_006760_12 euxassay_006760_13 euxassay_006760_14
EMAGE:11545 EMAGE:11545 EMAGE:11545 EMAGE:11545 EMAGE:11545
euxassay_006760_15 euxassay_006760_16 euxassay_006760_17 euxassay_006760_18 euxassay_006760_19
EMAGE:11545 EMAGE:11545 EMAGE:11545 EMAGE:11545 EMAGE:11545
euxassay_006760_20 euxassay_006760_21 euxassay_006760_22 euxassay_006760_23 euxassay_006760_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11545Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11545_wholemount_strong.wlz
11545_wholemount_moderate.wlz
11545_wholemount_weak.wlz
11545_wholemount_possible.wlz
11545_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11545_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 1
moderate moderate
regionalmoderate expression: see section 07 08 09 22 24 weak expression: see section 06
hindlimb digit 2
moderate moderate
regionalmoderate expression: see section 07 08 09 22 24 weak expression: see section 06
hindlimb digit 3
moderate moderate
regionalmoderate expression: see section 07 08 09 22 24 weak expression: see section 06
hindlimb digit 4
moderate moderate
regionalmoderate expression: see section 07 08 09 22 24 weak expression: see section 06
hindlimb digit 5
moderate moderate
regionalmoderate expression: see section 07 08 09 22 24 weak expression: see section 06
fibula
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07
tibia
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07
femur
moderate moderate
regionalmoderate expression: see section 03 04 08 09 11 12 21 22 23 weak expression: see section 05 06 07
vibrissa
moderate moderate
regionalmoderate expression: see section 09 11 22 23 24 weak expression: see section 10 12
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 13 14
diencephalon lateral wall mantle layer
moderate moderate
spottedmoderate expression: see section 07 08 09 10 11 12 14 15 16 17 18 19 20
cerebral cortex mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 17 18 19 20 21 22 23 24
telencephalon mantle layer
moderate moderate
spottedmoderate expression: see section 05 06 07 08 21 22 23 24
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 14
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
pons ventricular layer
strong strong
regionalstrong expression: see section 13 14
midbrain ventricular layer
strong strong
regionalstrong expression: see section 12 13 14
tegmentum
moderate moderate
regionalmoderate expression: see section 10 11 12 15 16 17 18 19
spinal cord mantle layer
strong strong
regionalstrong expression: see section 14 moderate expression: see section 11 12 13 15 16 17 18
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 17 18 19 20 21 22
esophagus
moderate moderate
regionalmoderate expression: see section 15
rectum
moderate moderate
regionalmoderate expression: see section 17
renal cortex
strong strong
regionalstrong expression: see section 13 21 moderate expression: see section 09 10 11 12 14 20 22 23 24
genital tubercle of male
moderate moderate
regionalmoderate expression: see section 14 15 16 17 18 19 20
tail paraxial mesenchyme
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 18 19 20 21
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 18 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T7133
Entity Detected:Stxbp6, syntaxin binding protein 6 (amisyn) ( MGI:2384963)
Sequence:sense strand is shown

>T7133
CGGACGCGTGGGCCGCGCGGGAGCGGCGAGCCGCGATCAGCCAGAAGCCGAGCCGGCCCAGCTTAGTCTG
CAGCCCCGATCTCCGCGCGGGGCAGCCGCGGGGGAGCCCTGTCTTCGGTTGGGACGCGTGCCGCGCACTA
GGCACCGCCCGAGCACGAGCCAGGCTGCACGAAAATTCCCTGCGTGCCCTCCTGGGTGGCTCTACAATGA
GTGCCAAGTCTGCCATCAGCAAGGAAATTTTTGCACCTCTTGATGAAAGAATGCTGGGAGCCGTCCAAGT
CAAGAGAAGGACAAAGAAAAAGATTCCTTTCTTGGCAACTGGGGGTCAAGGCGAATACTTAACTTATATC
TGCCTGTCAGTGACAAACAAAAAACCCACACAGGCATCTATCACGAAGGTCAAACAGTTTGAGGGCTCCA
CATCATTCGTCCGAAGATCCCAATGGATGCTTGAGCAGCTTCGCCAAGTTAATGGTATTGATCCTAATCG
GGATTCTGCAGAGTTTGATTTGTTGTTTGAAAATGCCTTTGACCAGTGGGTTGCTAGCACGGCCTCAGAA
AAGTGCACCTTCTTCCAGATCCTCCACCACACCTGCCAGAGGTACCTCACAGACAGGAAGCCAGAGTTTA
TTAACTGCCAATCCAAAATTATGGGAGGAAACAGCATCCTCCATTCAGCAGCTGATAGTGTGACCAGTGC
AGTACAGAAGGCAAGCCAGGCCTTGAACGAGCGTGGGGAACGGTTAGGCCGAGCAGAGGAGAAGACAGAA
GACATGAAGAACAGTGCCCAGCAGTTTGCAGAAACCGCACACAAGCTTGCCATGAAGCATAAATGTTGAG
AAACTGCCTATCCTGGTGAAGCTCTAAAGAAAGTGGAGGAGTTTGTTCAGCAGTTATTACAAGACATCCA
GACGGGGCTGCTTCTTTGGTTTTGCTGTTTTGTTTGTTTGTTTGTTTGTTTCTCTTTCTTTCTTTCTTTC
TTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCCCAATATAAG
GACATTGAAGGGTTTGATTCTTCATGGTCAGATGTTAATATGAATGAATGGCAGCATGCTGTGGGCACAT
ATTTCCCTATCTTGCTAAAGAATGCTGCAATAGTGTCAGCTTCATTTTTACTTTTTCCATTGTCTGTGTG
TGTGTGTGTGTGTGTGTATGTGTGTGTATGTATATCTGTGTGTGTGCATATGTTCCTTTTGAAGGAAAAT
TGTTTTTGTAGTTCAAATACGAAATTCAGACCAAATAATAAGCCAGGTATAAATTGGCAAAATGTATTTT
TTTGTTTCTCTCTGTAACTAAGCAACAAAATAGTTCAATATGGTGGCATCAGGTGATGGTCCTGGGTACA
AATAAAAGCCACATAATGCTTTTGCCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:4020199 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:4020199 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11544 same embryo
 EMAGE:11541 same embryo
 EMAGE:11543 same embryo
 EMAGE:11542 same embryo
 EurExpress:euxassay_006760 same experiment
 MGI:4828532 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS