Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11656

Phlda1 pleckstrin homology-like domain, family A, member 1 ( MGI:1096880)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11656 EMAGE:11656 EMAGE:11656 EMAGE:11656 EMAGE:11656
"Pseudo-wholemount" of euxassay_008411. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008411_01 euxassay_008411_02 euxassay_008411_03 euxassay_008411_04
EMAGE:11656 EMAGE:11656 EMAGE:11656 EMAGE:11656 EMAGE:11656
euxassay_008411_05 euxassay_008411_06 euxassay_008411_07 euxassay_008411_08 euxassay_008411_09
EMAGE:11656 EMAGE:11656 EMAGE:11656 EMAGE:11656 EMAGE:11656
euxassay_008411_10 euxassay_008411_11 euxassay_008411_12 euxassay_008411_13 euxassay_008411_14
EMAGE:11656 EMAGE:11656 EMAGE:11656 EMAGE:11656 EMAGE:11656
euxassay_008411_15 euxassay_008411_16 euxassay_008411_17 euxassay_008411_18 euxassay_008411_19
EMAGE:11656 EMAGE:11656 EMAGE:11656 EMAGE:11656 EMAGE:11656
euxassay_008411_20 euxassay_008411_21 euxassay_008411_22 euxassay_008411_23 euxassay_008411_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11656Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11656_wholemount_strong.wlz
11656_wholemount_moderate.wlz
11656_wholemount_weak.wlz
11656_wholemount_possible.wlz
11656_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11656_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 20 21 22 23 24
upper leg muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 20 21 22 23 24
diaphragm
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
forearm rest of mesenchyme
strong strong
regionalstrong expression: see section 01
hand
strong strong
regionalstrong expression: see section 01 02 03
foot
strong strong
regionalstrong expression: see section 04 05 06 07 08 20 21 22 23 24
lower leg rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
adrenal medulla
strong strong
regionalstrong expression: see section 08 09 10 11 17 18 19
thymus primordium
moderate moderate
spottedmoderate expression: see section 11 12 13 14 15
sublingual gland primordium
strong strong
regionalstrong expression: see section 11 12 16
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 08 09 10 17 18 19 20
pancreas
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18
thyroid gland
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16
vibrissa
strong strong
regionalstrong expression: see section 05 06 07 08 09 21 22 23 24
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
diencephalon meninges
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
telencephalon mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
telencephalon meninges
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
hindbrain meninges
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
pons mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain meninges
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 18
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 17 18 19 20 21 22
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 04 05 18
spinal cord mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17
spinal cord meninges
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17
dorsal root ganglion
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 16 17 18
inner ear
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 16 17 18 19 20 21 22 23
cornea
strong strong
regionalstrong expression: see section 04 05 23 24 moderate expression: see section 03
eye skeletal muscle
strong strong
regionalstrong expression: see section 06 07 08 21 22 23
retina
strong strong
regionalstrong expression: see section 02 04 23 24 moderate expression: see section 03
anterior naris
strong strong
regionalstrong expression: see section 14 15 16 17
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 16 17 18 19 20 moderate expression: see section 15
naso-lacrimal duct
strong strong
regionalstrong expression: see section 09 10 11 19
vomeronasal organ
strong strong
regionalstrong expression: see section 13
esophagus
strong strong
regionalstrong expression: see section 12 13
tongue
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17
stomach
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09
hindgut
strong strong
regionalstrong expression: see section 15
midgut
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
lower jaw incisor
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17
lower jaw molar
strong strong
regionalstrong expression: see section 08 19
upper jaw incisor
strong strong
regionalstrong expression: see section 12 13 14 16 17
upper jaw molar
strong strong
regionalstrong expression: see section 19
hepatic duct
strong strong
single cellstrong expression: see section 06
liver
strong strong
single cellstrong expression: see section 01 02 03 04 05 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
bladder
strong strong
regionalstrong expression: see section 12 13 14 15 16
metanephros
strong strong
regionalstrong expression: see section 07 08 09 10 11 17 18 19 20 21
kidney pelvis
strong strong
regionalstrong expression: see section 10 11 17
ureter
strong strong
regionalstrong expression: see section 12 14 15 16
left lung
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10
right lung
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17 18 19 20 21 22 23 24
trachea cartilaginous ring
strong strong
regionalstrong expression: see section 13 14
tail paraxial mesenchyme
strong strong
regionalstrong expression: see section 13 14 15 16 17 18
axial skeleton tail region
strong strong
regionalstrong expression: see section 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T5835
Entity Detected:Phlda1, pleckstrin homology-like domain, family A, member 1 ( MGI:1096880)
Sequence:sense strand is shown

>T5835
GGCCGCGGAAGCCGCTGGGGCGAGGACGGCGCAGGGCTGCTACTGCTACCCCCAGCCGGAGCGTCTGGAA
GCCTGAAGGCCGAGCGGAGCAGCAGCACCCCTTATGCCGGAAGGATGCTGGAGAACAGCGGCTGCAAGGC
GCTGAAGGAAGGAGTGCTGGAAAAGCGAAGCGACGGGCTGCTGCAGCTCTGGAAGAAAAAGTGCTGCATC
CTCACCGAGGAAGGGCTACTGCTCATACCGCCCAAGCAGCTACAACAGCAGCAGCAGCAGCAACAGCCCG
GGCAGGGGACGGCCGAACCGTCCCAACCTAGTGGCCCCACCGTCGCCAGCCTTGAGCCACCAGTCAAGCT
GAAGGAATTGCACTTTTCCAATATGAAGACTGTAGACTGCGTGGAGCGCAAGGGCAAGTACATGTACTTC
ACTGTGGTGATGACGGAGGGCAAAGAGATCGACTTTCGGTGCCCCCAGGACCAGGGCTGGAACGCCGAGA
TCACGTTGCAGATGGTGCAGTACAAAAATCGCCAGGCCATACTGGCGGTCAAGTCTACCAGGCAGAAGCA
GCAGCACCTGGTCCAGCAGCAGCCTCCGCAGACGCAGCAGATCCAACCCCAGCCCCAGCCGCAGATCCAA
CCCCAGCCCCAGCCGCAGATCCAGCCTCAACCCCAACCCCAGCCCCAACCTCAGCCCCAACCTCAGCCCC
AACCCCAACCCCAACAGCTCCACTCCTACCCGCATCCGCATCCTCATCCTTACTCTCACCCGCACCAGCA
CCCACACCCGCACCCGCACCCGCACCCTCACCCTCACCCTCACCCGTACCAACTCCAGCACGCGCACCAG
CCTCTTCACTCGCAGCCGCAGGGTCACCGGCTTCTCCGCAGCACCTCCAACTCTGCCTGAAGAGGGCGGC
ACCCGGGCCACTCAAGGTTTTGAGGACTTCGGAAAGTGGGAAGAGTGCATTGCTATTCAGTTCACTTGGA
TCAAAACCAACAGAGTCTCCCCACCCCGCGCCTGATCAAGTAGTTTGGACTTCACCCGACGGATAACGCG
CGCTTGCAGTTCCCTCGTAGTTTTCTGCATAATGTTCATCACAGTTGCAGGAAGCAGATTTTGCGTCGAG
ATGACTTTATTTATGGACCTTTGGAAGGATCACCTAACGTAATGGACCTTTGTAGGAACAATTTATGTAC
TGTAATTTTATTTTAATGTTATTTTGGATTATGATTATTTATTAGTTTTTTTATGCCTAATCTAAGACAT
TTCTGAATGTAGGCCACCTCCTCCCCCTCCTCGCCAAAAAGAAAAAGAAAAAAAGAAAAAAAAAAAAGAA
ACTTTATTTTCAGAAACAGATTTCTTAGTAAGCCCTGATCTTGGAAGAGAAAAAGGGAAAGGGGTGGTGG
AGGGGGGCAAACATGAAAAAAAAATGGGTTCAGTATTCCCAGGACATTCTCATAAAGTCGACTCTTTCAT
TGTATTTGAAGACGTTGAAATTAAATTCTGATATTACTTTCAAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:3153799 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:3153799 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11660 same embryo
 EMAGE:11657 same embryo
 EMAGE:11658 same embryo
 EMAGE:11659 same embryo
 EMAGE:11655 same embryo
 EurExpress:euxassay_008411 same experiment
 MGI:4827190 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS