Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11783

Itga10 integrin, alpha 10 ( MGI:2153482)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11783 EMAGE:11783 EMAGE:11783 EMAGE:11783 EMAGE:11783
"Pseudo-wholemount" of euxassay_011003. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011003_01 euxassay_011003_02 euxassay_011003_03 euxassay_011003_04
EMAGE:11783 EMAGE:11783 EMAGE:11783 EMAGE:11783 EMAGE:11783
euxassay_011003_05 euxassay_011003_06 euxassay_011003_07 euxassay_011003_08 euxassay_011003_09
EMAGE:11783 EMAGE:11783 EMAGE:11783 EMAGE:11783 EMAGE:11783
euxassay_011003_10 euxassay_011003_11 euxassay_011003_12 euxassay_011003_13 euxassay_011003_14
EMAGE:11783 EMAGE:11783 EMAGE:11783 EMAGE:11783 EMAGE:11783
euxassay_011003_15 euxassay_011003_16 euxassay_011003_17 euxassay_011003_18 euxassay_011003_19
EMAGE:11783 EMAGE:11783 EMAGE:11783 EMAGE:11783 EMAGE:11783
euxassay_011003_20 euxassay_011003_21 euxassay_011003_22 euxassay_011003_23 euxassay_011003_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11783Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11783_wholemount_strong.wlz
11783_wholemount_moderate.wlz
11783_wholemount_weak.wlz
11783_wholemount_possible.wlz
11783_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11783_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 05 06 07 19 20 21 weak expression: see section 01 02 03 04 08 09 10 16 17 18 22 23 24
humerus
moderate moderate
regionalmoderate expression: see section 01 02 weak expression: see section 23 24
tarsus
moderate moderate
regionalmoderate expression: see section 02 weak expression: see section 03
hip
weak weak
regionalweak expression: see section 10 11 18 19
fibula
moderate moderate
regionalmoderate expression: see section 01 02 weak expression: see section 03
tibia
moderate moderate
regionalmoderate expression: see section 01 02 weak expression: see section 03
femur
weak weak
regionalweak expression: see section 05 06 07 20 21 22 23 24
pituitary gland
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 10 11 12 15
otic capsule
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 16 17
nasal septum
moderate moderate
regionalmoderate expression: see section 13 17
mandible
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 15 16 17 18 19 20 21 moderate expression: see section 12 22
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 weak expression: see section 07 08 09 10
maxilla
strong strong
regionalstrong expression: see section 04 05 06 07 09 10 11 16 17 18 19 20 21 moderate expression: see section 12 22 weak expression: see section 08
axial skeleton cervical region
weak weak
regionalweak expression: see section 08 09 10 11 12 15 16 17
axial skeleton lumbar region
weak weak
regionalweak expression: see section 11 12 13 14 15 16 17 18 19
axial skeleton sacral region
weak weak
regionalweak expression: see section 14 15 17
axial skeleton thoracic region
weak weak
regionalweak expression: see section 09 10 11 12 13 14 16 17 18 19
basioccipital bone
moderate moderate
regionalmoderate expression: see section 01 02 03 05 06 18 19 20 21 22 weak expression: see section 04 23
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 18 19 20 21 weak expression: see section 15 22 23
temporal bone petrous part
moderate moderate
regionalmoderate expression: see section 01 02 03 21
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 03 18 19 20 22 23 weak expression: see section 04 05 24
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
scapula
weak weak
regionalweak expression: see section 03 04 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36523
Entity Detected:Itga10, integrin, alpha 10 ( MGI:2153482)
Sequence:sense strand is shown

>T36523
GAGGAGAAAAAGCCACAAGAGACATTCTGTACAATTCCAGGGCACAGAGAATCCTTCAGACCGGCAACTG
CCAGCCGGCTGAAACCTGAGACTTCACAGTACTCCGCCCTCAGGTGCTAGGGAAACCCAGCTGCCCCCAG
GCTCTCCGGGCTGAGGCATCCCAACCCTCATCCTTCTCTGGGAGCAAGGCCAGGACTTGATGCTAAAATT
TCCGGAGCCAGAGGCCCCCAAGTGGTTCAAGCTGGGATAGCAGGGGAGCTTGGTGACAATTTTCTCCATT
TACTCTTCGGGGCTTTCGTAACTGAAAGCTTCACGGTGGCAGGAAGAAGCCCTTTCACCGCACCAGGTTT
GGGTAACAACAGCCCCCTGAGATAGATCCAAACAAGCGGGAATCTGCATCTGGGAGGAAGCCTACATGGT
TGGCATCAGGTGTCTGGAGAGTAAGCACCTTCTTGCCCAGTGTTGGCGCTATAGCGGTGATAGCCTGGGA
AGACCATTCTGAGACTCCTGTCATGTGCTGTAGGTGTCTCTGCTGCAGTGAGTTTTTCAGCCCTTTCTTG
ATCACCTTTTCTGGAAATTGCGTGTTGACTAAACCCTCTCCCTTTTGTCCTATGTTTTGGTTCATGGGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 77412. Forward Primer - name:077412_F_cDNA_Itga10, sequence:GAGGAGAAAAAGCCACAAGAGA; Reverse Primer - name:077412_N_SP6_cDNA_Itga10, sequence:ACCCATGAACCAAAACATAGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11782 same embryo
 EMAGE:11785 same embryo
 EMAGE:11784 same embryo
 EMAGE:11781 same embryo
 EurExpress:euxassay_011003 same experiment
 MGI:4825637 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS