Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11815

Cacng4 calcium channel, voltage-dependent, gamma subunit 4 ( MGI:1859167)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11815 EMAGE:11815 EMAGE:11815 EMAGE:11815 EMAGE:11815
"Pseudo-wholemount" of euxassay_008284. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008284_01 euxassay_008284_02 euxassay_008284_03 euxassay_008284_04
EMAGE:11815 EMAGE:11815 EMAGE:11815 EMAGE:11815 EMAGE:11815
euxassay_008284_05 euxassay_008284_06 euxassay_008284_07 euxassay_008284_08 euxassay_008284_09
EMAGE:11815 EMAGE:11815 EMAGE:11815 EMAGE:11815 EMAGE:11815
euxassay_008284_10 euxassay_008284_11 euxassay_008284_12 euxassay_008284_13 euxassay_008284_14
EMAGE:11815 EMAGE:11815 EMAGE:11815 EMAGE:11815 EMAGE:11815
euxassay_008284_15 euxassay_008284_16 euxassay_008284_17 euxassay_008284_18 euxassay_008284_19
EMAGE:11815 EMAGE:11815 EMAGE:11815
euxassay_008284_20 euxassay_008284_21 euxassay_008284_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11815Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11815_wholemount_strong.wlz
11815_wholemount_moderate.wlz
11815_wholemount_weak.wlz
11815_wholemount_possible.wlz
11815_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11815_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
diencephalon meninges
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
telencephalon meninges
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
hindbrain meninges
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 20
midbrain meninges
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 12 13 14 15 16 17 18 19
midbrain lateral wall
strong strong
regionalstrong expression: see section 11
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 18 19 20 weak expression: see section 03 04
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 17 18 19 20 21 weak expression: see section 02 03 04
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 08
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 17 18
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 08 09
spinal cord
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17
spinal cord meninges
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10 11 12 17
cervical ganglion
moderate moderate
regionalmoderate expression: see section 08 09 17
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11 17 weak expression: see section 07
neural retina
strong strong
regionalstrong expression: see section 01 02 21 22
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 10 11 weak expression: see section 07 08 14 15 16 17
esophagus
moderate moderate
spottedmoderate expression: see section 13
stomach
moderate moderate
spottedmoderate expression: see section 01 02 03 05 06 07 08 09 10 11
midgut
moderate moderate
spottedmoderate expression: see section 11 12 13 14 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35121
Entity Detected:Cacng4, calcium channel, voltage-dependent, gamma subunit 4 ( MGI:1859167)
Sequence:sense strand is shown

>T35121
GGCAGGCCTCAGTAATATCATCGGTATCATCGTCTACATTTCCAGCAACACGGGCGACCCCAGTGACAAA
CGTGACGAAGACAAAAAGAACCATTACAACTACGGCTGGTCTTTTTACTTTGGAGCCCTGTCGTTTATTG
TGGCGGAGACCGTGGGCGTCCTGGCTGTAAACATTTACATTGAGAAAAATAAAGAGTTGAGGTTTAAGAC
CAAGCGGGAGTTCCTTAAGGCCTCTTCCTCCTCTCCTTACGCCAGGATGCCGAGCTACAGGTACCGGCGA
CGGCGGTCCAGGTCCAGTTCAAGGTCCACGGAGGCCTCACCCTCCAGGGATGCATCTCCCGTGGGCCTGA
AGATCACCGGAGCCATTCCCATGGGTGAGCTGTCCATGTACACGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 74877. Forward Primer - name:074877_F_cDNA_Cacng4, sequence:GGCAGGCCTCAGTAATATCATC; Reverse Primer - name:074877_N_SP6_cDNA_Cacng4, sequence:GCGTGTACATGGACAGCTCAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11812 same embryo
 EMAGE:11811 same embryo
 EMAGE:11814 same embryo
 EMAGE:11813 same embryo
 EurExpress:euxassay_008284 same experiment
 MGI:4823585 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS