Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11823

Kcnmb4 potassium large conductance calcium-activated channel, subfamily M, beta member 4 ( MGI:1913272)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11823 EMAGE:11823 EMAGE:11823 EMAGE:11823 EMAGE:11823
"Pseudo-wholemount" of euxassay_008263. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008263_01 euxassay_008263_02 euxassay_008263_03 euxassay_008263_04
EMAGE:11823 EMAGE:11823 EMAGE:11823 EMAGE:11823 EMAGE:11823
euxassay_008263_05 euxassay_008263_06 euxassay_008263_07 euxassay_008263_08 euxassay_008263_09
EMAGE:11823 EMAGE:11823 EMAGE:11823 EMAGE:11823 EMAGE:11823
euxassay_008263_10 euxassay_008263_11 euxassay_008263_12 euxassay_008263_13 euxassay_008263_14
EMAGE:11823 EMAGE:11823 EMAGE:11823 EMAGE:11823 EMAGE:11823
euxassay_008263_15 euxassay_008263_16 euxassay_008263_17 euxassay_008263_18 euxassay_008263_19
EMAGE:11823 EMAGE:11823 EMAGE:11823 EMAGE:11823
euxassay_008263_20 euxassay_008263_21 euxassay_008263_22 euxassay_008263_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11823Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11823_wholemount_strong.wlz
11823_wholemount_moderate.wlz
11823_wholemount_weak.wlz
11823_wholemount_possible.wlz
11823_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11823_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 1 phalanx
moderate moderate
regionalmoderate expression: see section 21 weak expression: see section 03
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 21 weak expression: see section 03
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 21 weak expression: see section 03
hindlimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 21 weak expression: see section 03
hindlimb digit 5 phalanx
moderate moderate
regionalmoderate expression: see section 21 weak expression: see section 03
tarsus
moderate moderate
regionalmoderate expression: see section 01 02 03 23
vibrissa
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 20 21 22 23
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 21 22 23
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 09 10 13 14 moderate expression: see section 08
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 09 moderate expression: see section 15 16
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 09 10 13 14 moderate expression: see section 08
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07 08 15 16 17 18 19
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07 08 15 16 17 18 19
midbrain ventricular layer
strong strong
regionalstrong expression: see section 14 moderate expression: see section 07 08 11 13 15
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 18 19 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 17 18 19 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 08
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 16 17 18
anterior naris
strong strong
regionalstrong expression: see section 12 13 16 17
external naris
strong strong
regionalstrong expression: see section 12 13 17 18
lower jaw incisor
strong strong
regionalstrong expression: see section 12 15 moderate expression: see section 11 16 17
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 19 20
upper jaw incisor
strong strong
regionalstrong expression: see section 15 moderate expression: see section 11 17
upper jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35251
Entity Detected:Kcnmb4, potassium large conductance calcium-activated channel, subfamily M, beta member 4 ( MGI:1913272)
Sequence:sense strand is shown

>T35251
GAAGCTCAGGGTGTCTTACGAGTACACGGAAGCCGAAGACAAGAGCATCCGGCTCGGCTTGTTCCTCATC
GTCTCCGGCATCCTGTCGCTCTTCATCTTCGGCTTCTGCTGGCTCAGTCCCGCCTTGCAGGATCTGCAAG
CCACGGCGGCCAACTGCACCGTGCTGTCGGTGCAGCAGATCGGCGAGGTGTTCGAGTGCACCTTCACCTG
TGGCACCGACTGCAGGGGCACCTCGCAGTATCCCTGCGTCCAGGTGTACGTGAACAACTCCGAGTCCAAC
TCCAGGGCGCTGCTACACAGCGACCAGCACCAGCTCCTGACCAACCCCAAGTGCTCCTATATCCCGCCCT
GTAAGAGAGAAAACCAGAAGAACTCGGAGAGCGTCATGAACTGGCAGCAGTATTGGAAAGATGAGATCGG
TTCCCAGCCATTCACTTGCTATTTTAATCAGCATCAGAGACCAGAGGACGTTCTCCTACAGCGCACACAC
GACGAGATTGCTCTCCTGCACTGCTTCCTCTGGCCGGTGGTGGCGTTTGTGGTGGGTGTTCTCATCGTGG
TCCTGACCATCTGTGCCAAGAGCCTGGCGGTCAAGGCGGAAGCCATGAAGAAACGCAAGTTCTCTTAACG
GGGAGGAGGAGGATTGTGGGAAGCCGAGACCAGAGGTTGCCTCGTCGGCACTCGCCTGCCCTGCAGAGCC
CACATTTGGTGGCGCAGGAGATGGAAGGGGCCGCAAGAGGCCCCCGAGAGGCCCCTCCCTCGTCGGCAGC
AGAAACAGGCACAGTTGGAAGACTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 90926. Forward Primer - name:090926_F_cDNA_Kcnmb4, sequence:GAAGCTCAGGGTGTCTTACGAG; Reverse Primer - name:090926_N_SP6_cDNA_Kcnmb4, sequence:CAGTCTTCCAACTGTGCCTGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4825727 same experiment
 EurExpress:euxassay_008263 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS