Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11852

Dcc deleted in colorectal carcinoma ( MGI:94869)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11852 EMAGE:11852 EMAGE:11852 EMAGE:11852 EMAGE:11852
"Pseudo-wholemount" of euxassay_009578. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009578_01 euxassay_009578_02 euxassay_009578_03 euxassay_009578_04
EMAGE:11852 EMAGE:11852 EMAGE:11852 EMAGE:11852 EMAGE:11852
euxassay_009578_05 euxassay_009578_06 euxassay_009578_07 euxassay_009578_08 euxassay_009578_09
EMAGE:11852 EMAGE:11852 EMAGE:11852 EMAGE:11852 EMAGE:11852
euxassay_009578_10 euxassay_009578_11 euxassay_009578_12 euxassay_009578_13 euxassay_009578_14
EMAGE:11852 EMAGE:11852 EMAGE:11852 EMAGE:11852 EMAGE:11852
euxassay_009578_15 euxassay_009578_16 euxassay_009578_17 euxassay_009578_18 euxassay_009578_19
EMAGE:11852 EMAGE:11852 EMAGE:11852 EMAGE:11852 EMAGE:11852
euxassay_009578_20 euxassay_009578_21 euxassay_009578_22 euxassay_009578_23 euxassay_009578_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11852Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11852_wholemount_strong.wlz
11852_wholemount_moderate.wlz
11852_wholemount_weak.wlz
11852_wholemount_possible.wlz
11852_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11852_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 moderate expression: see section 16 17 18
telencephalon mantle layer
strong strong
regionalstrong expression: see section 12 13 14 15 moderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 16 17 18 19 20 21 22 23 24
telencephalon marginal layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
olfactory cortex marginal layer
strong strong
regionalstrong expression: see section 11 12 13 14 17 18 19 20
medulla oblongata alar plate mantle layer
strong strong
single cellstrong expression: see section 07 09 13 14 15 moderate expression: see section 08
medulla oblongata alar plate marginal layer
strong strong
regionalstrong expression: see section 04 05 06 07 15 16 17 18 20 21 moderate expression: see section 08
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13
medulla oblongata basal plate marginal layer
strong strong
regionalstrong expression: see section 04 05 06 07 15 16 17 18 moderate expression: see section 08
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
pons mantle layer
strong strong
regionalstrong expression: see section 05 06 moderate expression: see section 07 08 09 10 11 12 13 14 15 16 17
pons marginal layer
strong strong
regionalstrong expression: see section 02 03 19 20
midbrain mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17
spinal cord mantle layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15
neural retina
strong strong
regionalstrong expression: see section 01 02 03 04 05 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36265
Entity Detected:Dcc, deleted in colorectal carcinoma ( MGI:94869)
Sequence:sense strand is shown

>T36265
ATGGTGACCAAGAACAGAAGGTCAAGCACGTGGAGCATGACTGCACACGCCACCACCTACGAAGCTGCCC
CAACTTCTGCTCCCAAGGATCTGACAGTCATTACTCGAGAGGGGAAGCCTCGTGCTGTCATTGTGAGCTG
GCAGCCTCCCTTGGAAGCCAATGGGAAAATCACTGCTTATATCTTGTTTTATACATTGGACAAGAATATA
CCAATAGATGATTGGATTATGGAAACTATCAGCGGTGACCGGCTTACCCATCAGATCATGGATCTCAGCC
TTGACACGATGTATTACTTTCGAATTCAAGCACGGAATGTGAAAGGAGTAGGGCCCCTCTCTGATCCCAT
CCTCTTCAGGACTTTGAAAGTGGAACACCCTGACAAAATGGCTAATGACCAAGGTCGTCATGGAGATGGG
GGTTATTGGCCAGTTGATACTAACTTGATTGATAGAAGCACTCTCAACGAACCACCCATTGGACAGATGC
ACCCCCCGCATGGCAGTGTCACTCCTCAGAAGAACAGCAACCTGCTTGTAATAACCGTGGTCACCGTTGG
TGTTCTCACTGTGTTGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 97634. Forward Primer - name:097634_F_cDNA_Dcc, sequence:ATGGTGACCAAGAACAGAAGGT; Reverse Primer - name:097634_N_SP6_cDNA_Dcc, sequence:CCAACACAGTGAGAACACCAAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11857 same embryo
 EMAGE:11855 same embryo
 EMAGE:11854 same embryo
 EMAGE:11856 same embryo
 EMAGE:11853 same embryo
 EurExpress:euxassay_009578 same experiment
 MGI:4824245 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS