Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11857

Daf2 decay accelerating factor 2 ( MGI:104849)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11857 EMAGE:11857 EMAGE:11857 EMAGE:11857 EMAGE:11857
"Pseudo-wholemount" of euxassay_009544. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009544_01 euxassay_009544_02 euxassay_009544_03 euxassay_009544_04
EMAGE:11857 EMAGE:11857 EMAGE:11857 EMAGE:11857 EMAGE:11857
euxassay_009544_05 euxassay_009544_06 euxassay_009544_07 euxassay_009544_08 euxassay_009544_09
EMAGE:11857 EMAGE:11857 EMAGE:11857 EMAGE:11857 EMAGE:11857
euxassay_009544_10 euxassay_009544_11 euxassay_009544_12 euxassay_009544_13 euxassay_009544_14
EMAGE:11857 EMAGE:11857 EMAGE:11857 EMAGE:11857 EMAGE:11857
euxassay_009544_15 euxassay_009544_16 euxassay_009544_17 euxassay_009544_18 euxassay_009544_19
EMAGE:11857 EMAGE:11857 EMAGE:11857 EMAGE:11857 EMAGE:11857
euxassay_009544_20 euxassay_009544_21 euxassay_009544_22 euxassay_009544_23 euxassay_009544_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11857Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11857_wholemount_strong.wlz
11857_wholemount_moderate.wlz
11857_wholemount_weak.wlz
11857_wholemount_possible.wlz
11857_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11857_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 05 weak expression: see section 04 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
trigeminal v ganglion
weak weak
regionalweak expression: see section 04 05 06 07 08 09 19 20 21 22 23
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 11 12 13 14 15 17 18 19 20 21 moderate expression: see section 10 weak expression: see section 16
aorta
moderate moderate
regionalmoderate expression: see section 12 13 14
esophagus
moderate moderate
regionalmoderate expression: see section 11 12
esophagus mesentery
moderate moderate
regionalmoderate expression: see section 13 14
stomach
moderate moderate
regionalmoderate expression: see section 08 09 10
stomach mesentery
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09
rectum
strong strong
regionalexpression in the associated mesenchyme.
rectum mesentery
strong strong
regionalstrong expression: see section 13 14 15
rest of midgut mesentery
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 14
palatal shelf
moderate moderate
regionalmoderate expression: see section 10 17
liver
moderate moderate
single cellmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
bladder
strong strong
regionalstrong expression: see section 13 moderate expression: see section 12 14 15
metanephros
moderate moderate
regionalmoderate expression: see section 06 07 08 09 17 18
metanephros
moderate moderate
regionalmoderate expression: see section 06 07 08 09 16 17 18 19
left lung
moderate moderate
regionalmoderate expression: see section 04 05 06 07 09 10 weak expression: see section 08
right lung
moderate moderate
regionalmoderate expression: see section 14 15 17 18 19
trachea mesenchyme
moderate moderate
regionalmoderate expression: see section 12 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36262
Entity Detected:Daf2, decay accelerating factor 2 ( MGI:104849)
Sequence:sense strand is shown

>T36262
CAGACACTCCAAGTTTGCTGAGCAAAGCAAAGTGGCATACTCGTGTAATAACGGCTTTAAACAAGTTCCA
GACAAGTCAAACATAGTTGTCTGTCTTGAAAATGGCCAATGGTCGAGCCACGAAACATTCTGTGAGAAAT
CATGTGATACTCCAGAAAGACTGAGTTTTGCATCCCTCAAAAAAGAGTACTTCAACATGAATTTTTTCCC
AGTTGGTACTATTGTGGAATATGAGTGTCGGCCAGGATTTCGAAAACAACCTTCACTCTCAGGAAAATCA
ACTTGCCTTGAGGATTTAGTATGGTCTCCAGTTGCTCAGTTTTGTAAAAAAAAATCATGCCCTAATCCTA
AAGATCTGGATAATGGTCACATCAACATACCAACCGGAATATTATTCGGTTCAGAAATAAACTTCTCATG
CAACCCAGGGTACAGGCTAGTCGGTATCACCTCTATTTTATGTACTATTACAGGAAATGCTGTTGATTGG
GATGATGAATTTCCAGTGTGCACAGAAATATTTTGTCCAGACCCACCAAAAATCAACGATGGAATAATGC
GAGGGGAAAGCGATTCTTATAAATATAGCCAGGTGGTCATTTATTCATGTGACAAAGGCTTCATCCTGTT
TGGAAATTCTACCATATATTGTACTGTGAGCAAGTCTGATGTAGGACAATGGAGCAGTCCACCACCCCAG
TGTATAGAGGAATCTAAGGTCCCAATTAAGAAACCAGTAGTTAATGTTCCAAGTACAGGAATCCCCTCAA
CGCCTCAGAAACCCACAACAGAAAGTGTTCCAAATCCAGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 97624. Forward Primer - name:097624_F_cDNA_Daf2, sequence:CAGACACTCCAAGTTTGCTGAG; Reverse Primer - name:097624_N_SP6_cDNA_Daf2, sequence:CCTGGATTTGGAACACTTTCTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11855 same embryo
 EMAGE:11854 same embryo
 EMAGE:11856 same embryo
 EMAGE:11852 same embryo
 EMAGE:11853 same embryo
 EurExpress:euxassay_009544 same experiment
 MGI:4824225 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS