Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11890

Ckap5 cytoskeleton associated protein 5 ( MGI:1923036)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11890 EMAGE:11890 EMAGE:11890 EMAGE:11890 EMAGE:11890
"Pseudo-wholemount" of euxassay_011048. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011048_01 euxassay_011048_02 euxassay_011048_03 euxassay_011048_04
EMAGE:11890 EMAGE:11890 EMAGE:11890 EMAGE:11890 EMAGE:11890
euxassay_011048_05 euxassay_011048_06 euxassay_011048_07 euxassay_011048_08 euxassay_011048_09
EMAGE:11890 EMAGE:11890 EMAGE:11890 EMAGE:11890 EMAGE:11890
euxassay_011048_10 euxassay_011048_11 euxassay_011048_12 euxassay_011048_13 euxassay_011048_14
EMAGE:11890 EMAGE:11890 EMAGE:11890 EMAGE:11890 EMAGE:11890
euxassay_011048_15 euxassay_011048_16 euxassay_011048_17 euxassay_011048_18 euxassay_011048_19
EMAGE:11890 EMAGE:11890 EMAGE:11890 EMAGE:11890
euxassay_011048_20 euxassay_011048_21 euxassay_011048_22 euxassay_011048_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11890Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11890_wholemount_strong.wlz
11890_wholemount_moderate.wlz
11890_wholemount_weak.wlz
11890_wholemount_possible.wlz
11890_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11890_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 11 12 13 14 15
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 17 19 weak expression: see section 07 08 09 10 16 18
vibrissa
weak weak
regionalweak expression: see section 06 07 20 21 22
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14
olfactory cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 10 11 16 17
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 14 15 16 17 18 19 20 21 22 weak expression: see section 12
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16
facial vii ganglion
weak weak
regionalweak expression: see section 04 20 21
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 07 18 19
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 18 19 20 21
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 07 17 18
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 10 17
cervical ganglion
weak weak
regionalweak expression: see section 09 17
thoracic ganglion
weak weak
regionalweak expression: see section 14
dorsal root ganglion
weak weak
regionalweak expression: see section 09 10 11 12 13 16 17 18 19
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 09 10 11 15 16 17 18 19
vomeronasal organ
weak weak
regionalweak expression: see section 15
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 11 12 13 16
lower jaw molar
weak weak
regionalweak expression: see section 07 08 09 18 19
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 11 12 13 16
upper jaw molar
weak weak
regionalweak expression: see section 07 08 09 18 19
renal cortex
moderate moderate
regionalmoderate expression: see section 09 10 18 19 20 21 weak expression: see section 08 11 12
lung
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
trachea
weak weak
regionalweak expression: see section 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35662
Entity Detected:Ckap5, cytoskeleton associated protein 5 ( MGI:1923036)
Sequence:sense strand is shown

>T35662
GGTTTTGGAGAAATCAGACCAGACCAATATCCTCAGTGCCCTGCTTGTTTTACTTCAGGACAGCCTGCTA
GCAACAGCTAGTTCTCCCAAATTCTCAGAGCTTGTTATGAAGTGTCTATGGAGAATGGTTCGACTATTAC
CTGACACCATCAACAGCATTAACCTAGACAGAATTCTTCTGGACATCCACATTTTCATGAAGGTCTTTCC
CAAAGAGAAATTGAAGCAATGCAAAAGTGAATTTCCTATAAGGACTCTAAAGACCCTTCTACATACTTTA
TGCAAATTAAAAGGACCTAAAATCCTAGACCACCTTACAATGATTGATAATAAGAATGAGTCAGAATTGG
AGGCCCACCTGTGTCGGATGATGAAGCATAGTATGGACCAGACTGGGAGCAAGTCTGATAAGGAAACAGA
AAAGGGAGCTTCTCGAATAGATGAAAAATCATCAAAGGCCAAAGTAAATGATTTCTTAGCTGAGATTTTT
AAGAAGATTGGCTCCAAAGAGAACACTAAGGAGGGCCTAGCAGAGTTATATGAAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 76677. Forward Primer - name:076677_F_cDNA_4930432B04Rik, sequence:GGTTTTGGAGAAATCAGACCAG; Reverse Primer - name:076677_N_SP6_cDNA_4930432B04Rik, sequence:ATTCATATAACTCTGCTAGGCCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11894 same embryo
 EMAGE:11893 same embryo
 EMAGE:11891 same embryo
 EMAGE:11892 same embryo
 EurExpress:euxassay_011048 same experiment
 MGI:4823887 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS