Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11895

Krt10 keratin 10 ( MGI:96685)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11895 EMAGE:11895 EMAGE:11895 EMAGE:11895 EMAGE:11895
"Pseudo-wholemount" of euxassay_011016. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011016_01 euxassay_011016_02 euxassay_011016_03 euxassay_011016_04
EMAGE:11895 EMAGE:11895 EMAGE:11895 EMAGE:11895 EMAGE:11895
euxassay_011016_05 euxassay_011016_06 euxassay_011016_07 euxassay_011016_08 euxassay_011016_09
EMAGE:11895 EMAGE:11895 EMAGE:11895 EMAGE:11895 EMAGE:11895
euxassay_011016_10 euxassay_011016_11 euxassay_011016_12 euxassay_011016_13 euxassay_011016_14
EMAGE:11895 EMAGE:11895 EMAGE:11895 EMAGE:11895 EMAGE:11895
euxassay_011016_15 euxassay_011016_16 euxassay_011016_17 euxassay_011016_18 euxassay_011016_19
EMAGE:11895 EMAGE:11895 EMAGE:11895 EMAGE:11895 EMAGE:11895
euxassay_011016_20 euxassay_011016_21 euxassay_011016_22 euxassay_011016_23 euxassay_011016_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11895Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11895_wholemount_strong.wlz
11895_wholemount_moderate.wlz
11895_wholemount_weak.wlz
11895_wholemount_possible.wlz
11895_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11895_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
spottedweak expression: see section 14 15
submandibular gland primordium
weak weak
regionalweak expression: see section 17 18 19 20
epidermis
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vibrissa
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 20 21 22 23 24
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 18 19 23 24 moderate expression: see section 20 21 22
cornea epithelium
strong strong
regionalstrong expression: see section 01 02 03 04 23 24
naris
strong strong
regionalstrong expression: see section 13 14 16 17 18 moderate expression: see section 12 15
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 11 12 13 16 weak expression: see section 09 10 18 19
esophagus
strong strong
regionalstrong expression: see section 11 12 13 14
stomach
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10
rectum
strong strong
regionalstrong expression: see section 15 16 17
lower jaw incisor
strong strong
regionalstrong expression: see section 11 12 13 16 17 18
lower jaw molar
strong strong
regionalstrong expression: see section 07 19
oral epithelium
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
palatal shelf epithelium
strong strong
regionalstrong expression: see section 11 12 13 14 15 16
upper jaw incisor
strong strong
regionalstrong expression: see section 12 13 16 17
upper jaw molar
strong strong
regionalstrong expression: see section 07 18 19
bladder
moderate moderate
regionalExpression in the fundus region.
urethra of male
moderate moderate
regionalmoderate expression: see section 15 16 17
larynx
strong strong
regionalstrong expression: see section 11 12 13 14
trachea
weak weak
regionalweak expression: see section 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36565
Entity Detected:Krt10, keratin 10 ( MGI:96685)
Sequence:sense strand is shown

>T36565
AGGAAGTGGTACGAGAAGCAAGGCAACTCAAGCCGCGAGAGCCCCGGGACTACAGCAAATACTACAAAAC
CATCGAGGACCTTAAGGGGCAGATCCTCACCCTGACAACTGACAATGCCAACGTGCTGCTGCAGATTGAT
AATGCCCGCCTGGCAGCTGATGACTTCAGGCTGAAATACGAGAATGAGGTGACCCTGCGCCAGAGCGTGG
AGGCCGACATCAATGGCCTGCGCAGGGTACTGGATGAGCTGACCCTTAGCCAGTCTGTCTTGGAATTGCA
GATCGAAAGTCTGAACGAAGAGCTGGCCTACCTAAAGAAGAACCTCGAAGAGGAAATGAGAGACCTCCAA
AATGTGTCCACTGGCGATGTGAACGTGGAAATGAACGCTGCCCCAGGGGTTGACCTGACTCAGCTGCTGA
ACAACATGAGAAACCAATACGAACAACTTGCAGAAAAGAATCGCAAGGATGCTGAAGAGTGGTTCAATCA
GAAGAGCAAGGAACTCACCACAGAAATCGACAGCAACATTGCACAAATGTCCAGCCATAAGTCTGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 100899. Forward Primer - name:100899_F_cDNA_Krt1-10, sequence:AGGAAGTGGTACGAGAAGCAAG; Reverse Primer - name:100899_N_SP6_cDNA_Krt1-10, sequence:TCAGACTTATGGCTGGACATT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11899 same embryo
 EMAGE:11900 same embryo
 EMAGE:11897 same embryo
 EMAGE:11898 same embryo
 EMAGE:11896 same embryo
 EurExpress:euxassay_011016 same experiment
 MGI:4825824 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS