Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11917

Zdbf2 zinc finger, DBF-type containing 2 ( MGI:1921134)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11917 EMAGE:11917 EMAGE:11917 EMAGE:11917 EMAGE:11917
"Pseudo-wholemount" of euxassay_011111. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011111_01 euxassay_011111_02 euxassay_011111_03 euxassay_011111_04
EMAGE:11917 EMAGE:11917 EMAGE:11917 EMAGE:11917 EMAGE:11917
euxassay_011111_05 euxassay_011111_06 euxassay_011111_07 euxassay_011111_08 euxassay_011111_09
EMAGE:11917 EMAGE:11917 EMAGE:11917 EMAGE:11917 EMAGE:11917
euxassay_011111_10 euxassay_011111_11 euxassay_011111_12 euxassay_011111_13 euxassay_011111_14
EMAGE:11917 EMAGE:11917 EMAGE:11917 EMAGE:11917 EMAGE:11917
euxassay_011111_15 euxassay_011111_16 euxassay_011111_17 euxassay_011111_18 euxassay_011111_19
EMAGE:11917 EMAGE:11917
euxassay_011111_20 euxassay_011111_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11917Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11917_wholemount_strong.wlz
11917_wholemount_moderate.wlz
11917_wholemount_weak.wlz
11917_wholemount_possible.wlz
11917_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11917_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 20 21
upper leg muscle
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 15 16 17 18 19 20 21
diaphragm
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
forearm rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03
hand
moderate moderate
regionalmoderate expression: see section 01 02 03
foot
moderate moderate
regionalmoderate expression: see section 04 05 17 18 19
lower leg rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
pituitary gland
moderate moderate
regionalmoderate expression: see section 12 13 14
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14
tongue muscle
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17
tail paraxial mesenchyme
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37362
Entity Detected:Zdbf2, zinc finger, DBF-type containing 2 ( MGI:1921134)
Sequence:sense strand is shown

>T37362
CAAACAGCTTTGAACTCCTGTGGATCTGAGCTAAACTTTCAAGATGATACCTTCTATCACTCTGACATTG
ACCCACCTCAACCTAAGAAAAAAGGCCAGGGTAAGAAAGTGACTTTTGACTTGAGAGTAACTAAGTATGA
ATATCCACCAAACCCAATGTACGGGGAAGGAGAAGAGGTTGCAGAAGATGATCTTAAGGAAGTAGTAGTT
CATGAAGCCTCACCTCAGGGTCAGGCTCCTCCATCAATTGTTGGAAAAACATGTCCTCAGGGGAGAGAAG
ATGATGTGAAGACAAACACACAGGCATGTCAAGGTTATTTCTATAGTTACTATGATGGTGGCTCTGAGAC
CAAGAAAATTCTTTTGGGTGAAGAAGAAAAGACCATTAGGTCTGACCTTAATCAGAACACCACATCAATT
CAACATGTTAAAGGTAAAGTTGGAGACACTGGTGACTTTTCAGTGGACTTAGGTAAACAGTCTTGTTCCT
TAGCAGAGGGGCTTCATCAGCAACATGGGCAGGTGACTTCTCAGAACCAAGTAGAAGTGAGATGTGGAAT
TCAAGCAAGTTCTGGGAAGAAAAGGAAAATTACAGAACAAGAAGAGGACTCACCAAAGAGGAAGTGTTTC
CACCATGATAGCCAGAAGAAGAAAAAGGCTCAAGCTGGGATAACTGAGCTACCTGAACCACAAACTAAAG
TTTTAGAGCCTGTACAGCCCGATTCCTTGGTCTATATTTTTTCTTCTCTAAGTATGAAGGAAGATCAGTC
TTTGAATCCACCTAAAACAAAGCCTGGCAGTGACAGTGATTTGCCACATATATACAGTTGTAGAGAACAC
ACCTCTTCTGGCCCACGACGTAAGAGAACTGTAATTAATCCTCCACAGAACCTAATGGTACCAGAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 75667. Forward Primer - name:075667_F_cDNA_4930431J08Rik, sequence:CAAACAGCTTTGAACTCCTGTG; Reverse Primer - name:075667_N_SP6_cDNA_4930431J08Rik, sequence:TTCTGGTACCATTAGGTTCTGTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11922 same embryo
 EMAGE:11916 same embryo
 EMAGE:11918 same embryo
 EMAGE:11919 same embryo
 EMAGE:11920 same embryo
 EMAGE:11921 same embryo
 EurExpress:euxassay_011111 same experiment
 MGI:4829279 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS