Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11918

Gm16434 predicted gene 16434 ( MGI:3646563)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11918 EMAGE:11918 EMAGE:11918 EMAGE:11918 EMAGE:11918
"Pseudo-wholemount" of euxassay_011202. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011202_01 euxassay_011202_02 euxassay_011202_03 euxassay_011202_04
EMAGE:11918 EMAGE:11918 EMAGE:11918 EMAGE:11918 EMAGE:11918
euxassay_011202_05 euxassay_011202_06 euxassay_011202_07 euxassay_011202_08 euxassay_011202_09
EMAGE:11918 EMAGE:11918 EMAGE:11918 EMAGE:11918 EMAGE:11918
euxassay_011202_10 euxassay_011202_11 euxassay_011202_12 euxassay_011202_13 euxassay_011202_14
EMAGE:11918 EMAGE:11918 EMAGE:11918 EMAGE:11918 EMAGE:11918
euxassay_011202_15 euxassay_011202_16 euxassay_011202_17 euxassay_011202_18 euxassay_011202_19
EMAGE:11918 EMAGE:11918 EMAGE:11918 EMAGE:11918
euxassay_011202_20 euxassay_011202_21 euxassay_011202_22 euxassay_011202_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11918Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11918_wholemount_strong.wlz
11918_wholemount_moderate.wlz
11918_wholemount_weak.wlz
11918_wholemount_possible.wlz
11918_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11918_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 09 10 11 18 19 20 21 weak expression: see section 07 08
forebrain
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
hindbrain
strong strong
homogeneousstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
midbrain
strong strong
homogeneousstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
facial vii ganglion
moderate moderate
single cellmoderate expression: see section 05 06 08 21 22
glossopharyngeal ix ganglion
moderate moderate
single cellmoderate expression: see section 08 19 20 weak expression: see section 07
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 04 05 06 07 08 09 10 19 20 21 22 23
vagus x ganglion
moderate moderate
single cellmoderate expression: see section 09 18
vestibulocochlear viii ganglion
moderate moderate
single cellmoderate expression: see section 08 09 10 18 19 20 21 weak expression: see section 07
trigeminal v nerve
moderate moderate
single cellmoderate expression: see section 11 19
spinal cord
strong strong
homogeneousstrong expression: see section 09 10 11 12 13 14 15 weak expression: see section 16
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10 17
cervical ganglion
moderate moderate
regionalmoderate expression: see section 10 17
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 12 14
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 07 09 10 11 16 17 18 weak expression: see section 08
pharyngo-tympanic tube
weak weak
regionalweak expression: see section 01 02 03 04
neural retina
moderate moderate
regionalmoderate expression: see section 03 04 05 weak expression: see section 02
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 18 19 21 22
heart atrium
moderate moderate
single cellmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
heart ventricle
moderate moderate
single cellmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
esophagus
weak weak
regionalweak expression: see section 13
tongue
strong strong
single cellstrong expression: see section 15 16
stomach
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 weak expression: see section 08 09
hindgut
weak weak
regionalweak expression: see section 12 13
midgut
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15 16 17
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 17 18 weak expression: see section 13 14
lower jaw molar
moderate moderate
regionalmoderate expression: see section 21 weak expression: see section 09
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 18 weak expression: see section 14
upper jaw molar
moderate moderate
regionalmoderate expression: see section 21 weak expression: see section 09
urethra of male
moderate moderate
regionalmoderate expression: see section 12 13 14
lung
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 17 18 21 22 moderate expression: see section 11 13 14 16 19 20 weak expression: see section 04 15
sacral vertebral cartilage condensation
strong strong
regionalstrong expression: see section 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37381
Entity Detected:Gm16434, predicted gene 16434 ( MGI:3646563)
Sequence:sense strand is shown

>T37381
GAACAGCAGCTTCCCTAAGTGTGAAACAGTCTAACAGAAACTGGAAAATGGCACAGACCACGACATGATC
TCCCTCAAAGAGAAGTGCTGGAGGAAGAGCACTGCGTGTGCACAGGAAATACACCACTGTTGCCTCTCAT
CCCTAATAACCATGGCTGTAATGGGCTGCATGCTCCTCCTTTATTTTGGTTTCTTGGGTATGAACAGGCC
TTAATTTCATCTAGCCTCTGGCCCAGGAAGAGTGCACATTTAAAGGGACTTAGAGAAATGCTGAGACACA
TCAAGAGCTGCTGGGCATCCTGGAAGAATCTGAGAGTTTAAATTTATCTTTTCCTGATGGGTCATCATCA
ATAATTACATGGAGATCAGTCAACAAAATTGTAAATCCTTGGATCCAAGTTTACAACATGTGTTCTGCTT
TGACTTGGGAGGCCATATCCTTCAGACCCACACTCCAAAAGGAGAGTGTTGCTTAAATTTCTCCTGCAAA
GATTGTTACCTCCAGGAACTGCTTTTCTGCTAAGTTGCCAAGGACAGCCACAGGCTGTAAGGCAGTGCTA
CAAAATGAGCAGACTAAGAAATTTGCTTTGCACAATTTTTGTGGTTTGATTTTGGTTTGAGTTATGATTA
GTTTAGTTACTTGGTTTTTCTTGTTTTCATTTGAAGTTTTGTTATTTATTGGTTGTTTATTTGTTCTTGT
AATTAATTTGATATTTTGGTAAGGCTAAACAGAGTACACACTGACTGTCAGCTTTCAGTTACAATTGAGT
ACATTGTATTTATTCTTAGGACTAACACAATGATCTCCAAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 68587. Forward Primer - name:068587_F_cDNA_4930555G01Rik, sequence:GAACAGCAGCTTCCCTAAGTGT; Reverse Primer - name:068587_N_SP6_cDNA_4930555G01Rik, sequence:GTTGGAGATCATTGTGTTAGTCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11919 same assay
 EMAGE:11920 same assay
 EMAGE:11921 same assay
 EurExpress:euxassay_011202 same experiment
 EMAGE:11917 same embryo
 EMAGE:11916 same embryo
 MGI:4822739 same experiment
 MGI:4822738 same experiment
 MGI:4822737 same experiment
 MGI:4822740 same experiment
 EMAGE:11922 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS