Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11936

Dcx doublecortin ( MGI:1277171)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11936 EMAGE:11936 EMAGE:11936 EMAGE:11936 EMAGE:11936
"Pseudo-wholemount" of euxassay_009545. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009545_01 euxassay_009545_02 euxassay_009545_03 euxassay_009545_04
EMAGE:11936 EMAGE:11936 EMAGE:11936 EMAGE:11936 EMAGE:11936
euxassay_009545_05 euxassay_009545_06 euxassay_009545_07 euxassay_009545_08 euxassay_009545_09
EMAGE:11936 EMAGE:11936 EMAGE:11936 EMAGE:11936 EMAGE:11936
euxassay_009545_10 euxassay_009545_11 euxassay_009545_12 euxassay_009545_13 euxassay_009545_14
EMAGE:11936 EMAGE:11936 EMAGE:11936 EMAGE:11936 EMAGE:11936
euxassay_009545_15 euxassay_009545_16 euxassay_009545_17 euxassay_009545_18 euxassay_009545_19
EMAGE:11936 EMAGE:11936 EMAGE:11936 EMAGE:11936 EMAGE:11936
euxassay_009545_20 euxassay_009545_21 euxassay_009545_22 euxassay_009545_23 euxassay_009545_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11936Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11936_wholemount_strong.wlz
11936_wholemount_moderate.wlz
11936_wholemount_weak.wlz
11936_wholemount_possible.wlz
11936_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11936_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 22 23 24
upper leg muscle
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 21 22 23 24
diaphragm
weak weak
regionalweak expression: see section 01 02 03 05 06 07 09 10 11 19 20 21 22 23 24
forearm rest of mesenchyme
weak weak
regionalweak expression: see section 01
hand
weak weak
regionalweak expression: see section 01 02 03 04 05 23 24
foot
weak weak
regionalweak expression: see section 05 06 07 08
lower leg rest of mesenchyme
weak weak
regionalweak expression: see section 01 02 03 04 05
vertebral axis musculature
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
brain
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
facial vii ganglion
strong strong
regionalstrong expression: see section 05 06 07 08 20 21 22 23
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 08 19 20
trigeminal v ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 18 19 20 21 22 23
vagus x ganglion
strong strong
regionalstrong expression: see section 09 19
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 07 08 09 18 19 20
trigeminal v nerve
strong strong
regionalstrong expression: see section 10 17 18
spinal cord
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17 18
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 11 13 17
cervical ganglion
strong strong
regionalstrong expression: see section 10 18 moderate expression: see section 11 17
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 13 14 15 weak expression: see section 16
dorsal root ganglion
strong strong
regionalstrong expression: see section 09 10 11 12 13 17 18 19
neural retina
strong strong
regionalstrong expression: see section 01 02 03 23 24
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 10 11 12 13 15 16 17 18 19
tongue muscle
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 11 12 14 15
stomach
moderate moderate
spottedmoderate expression: see section 05 06 09 weak expression: see section 07 08
midgut
moderate moderate
spottedmoderate expression: see section 10 11 13 14 15 16 17 18
renal capsule
moderate moderate
regionalmoderate expression: see section 08 09 21 22 weak expression: see section 10 11 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36269
Entity Detected:Dcx, doublecortin ( MGI:1277171)
Sequence:sense strand is shown

>T36269
TAACACCAACTGTTCACGATCCAGGACTGCCTGTCCATGTATCAATAATGAGCAGTCTTAAGTCTGCTAA
TTAATTCAGAAACCTTGGGGATGTCAATGTCACTGCTTGGCAGTACCATATGCATTGCCCATTTTTCCAG
TAACTTTTCTTTCTAAGTTCTCTTAAAGACTTTTGAGAAAGTAAGAAGCTAAGTGAACATATATCCAATG
TTTTGTAATGTATTATATTGCAGCATTAAGTCAACAACCCCTTATGACGTGTACCCAGCTAATGCATGGT
TTCAGAGTGGATTTTGCATTTTTCATGTGCAGTAAATGATTTAAAAATGTTTTTGGTCACCTTTTTGTGC
CATTAAACTTGTACAGAAAATGCTTTTATGGCCATTTTCAATGGGAGAAAGTTAAAAAATGGAAACAGCC
CACCCTTTCTGCCCTATAGCTGTAGTTAGAATTGAGTACATGTAGAAATACGGCTGTAATTGGTGGTTGT
AGTGTTATAGTTGTTAGCTTGCTAGTGACTGCCTTTGGAGAGTAAATGCATGGTCTTGTACATCACATTT
CTTAAATAACTCATTTTAACCTCTGAAAAGGATATATTATTCCATGTGGCCCTCTTCCCTCCCTCCATTC
CCTGCTCCCAGATATCTTACCATT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 96689. Forward Primer - name:096689_F_cDNA_Dcx, sequence:TAACACCAACTGTTCACGATCC; Reverse Primer - name:096689_N_SP6_cDNA_Dcx, sequence:AATGGTAAGATATCTGGGAGCAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11937 same embryo
 EMAGE:11935 same embryo
 EMAGE:11940 same embryo
 EMAGE:11939 same embryo
 EMAGE:11938 same embryo
 EurExpress:euxassay_009545 same experiment
 MGI:4824260 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS