Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11959

Insig1 insulin induced gene 1 ( MGI:1916289)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11959 EMAGE:11959 EMAGE:11959 EMAGE:11959 EMAGE:11959
"Pseudo-wholemount" of euxassay_011040. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011040_01 euxassay_011040_02 euxassay_011040_03 euxassay_011040_04
EMAGE:11959 EMAGE:11959 EMAGE:11959 EMAGE:11959 EMAGE:11959
euxassay_011040_05 euxassay_011040_06 euxassay_011040_07 euxassay_011040_08 euxassay_011040_09
EMAGE:11959 EMAGE:11959 EMAGE:11959 EMAGE:11959 EMAGE:11959
euxassay_011040_10 euxassay_011040_11 euxassay_011040_12 euxassay_011040_13 euxassay_011040_14
EMAGE:11959 EMAGE:11959 EMAGE:11959 EMAGE:11959 EMAGE:11959
euxassay_011040_15 euxassay_011040_16 euxassay_011040_17 euxassay_011040_18 euxassay_011040_19
EMAGE:11959 EMAGE:11959 EMAGE:11959 EMAGE:11959 EMAGE:11959
euxassay_011040_20 euxassay_011040_21 euxassay_011040_22 euxassay_011040_23 euxassay_011040_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11959Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11959_wholemount_strong.wlz
11959_wholemount_moderate.wlz
11959_wholemount_weak.wlz
11959_wholemount_possible.wlz
11959_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11959_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vibrissa
weak weak
regionalweak expression: see section 07 09 24
olfactory cortex ventricular layer
weak weak
homogeneousweak expression: see section 12 17 18
telencephalon ventricular layer
weak weak
homogeneousweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 16 17 18 19 20 21 22 23
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 07 08 18
trigeminal v ganglion
weak weak
regionalweak expression: see section 07 08 09 18 19
vagus x ganglion
weak weak
regionalweak expression: see section 17
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 10 16
cervical ganglion
weak weak
regionalweak expression: see section 09 17
thoracic ganglion
weak weak
regionalweak expression: see section 13 14 15
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 04 24
stomach
weak weak
regionalweak expression: see section 09 10 11
hindgut
weak weak
regionalweak expression: see section 15
rectum
weak weak
regionalweak expression: see section 15
midgut
moderate moderate
regionalmoderate expression: see section 17 18 weak expression: see section 10 11 12 13 14 15 16 20 21
mandible
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 19 20 21 22 23 24
lower jaw incisor
weak weak
regionalweak expression: see section 13 14 17 18
maxilla
weak weak
regionalweak expression: see section 06 07 08 09 10 19 20 21 22
upper jaw incisor
weak weak
regionalweak expression: see section 13 14 18
liver lobe
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 18 19 20 21 22 23 24
tail mesenchyme
weak weak
regionalweak expression: see section 14 15 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36513
Entity Detected:Insig1, insulin induced gene 1 ( MGI:1916289)
Sequence:sense strand is shown

>T36513
CTAGCAGTTTTGTGTCAGTGCCCAAAGGAGGGAGGTTGATGGTGCTTAACAGAGATGAAGTGTGTGTAGT
AAGAATATTTATCCAGAATTAAAATAAAGGGTTGTGTAAAGAGGGGTTGAGAGCAGCAGTGAGTTGGAGG
AAGATCATCTCCCAGTAGGACCTATAGTGCAGCCATATCTCCAGGTCACGCTCAGGCTGGCGCTCACGTG
TGGGTTTCATCAGTGTGGGAACGATGCTTTTTACTGCCGGGAGGTTTGTAGACGACAATCTCACTGAAAG
CCGAGGGCAGCACAAAGTCAGGGTTCTGCACTGCGATGCTGGACTTCTCACCTCAGTTTAAGAGAAGTTT
TATCCGAGCTCTGGACCATCTAAGAGTGAGTCGCTGTCTGCTGTTTCAGTCATAATGAGCCGAAATTGTG
TCTCTGTCACTCCAGGGTGGAGAGGACTCTTCCACAGCCCTGTGGAGCTTGCAATCTGTGATTGCTTCGT
AACAGGTTGAGTGTGCACGTCACTGTGTTAATTACGCAGTGTCCTATGTGCGTTGGACAGCATAGAACAC
AACACGTGGGACCTAACTTGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 94609. Forward Primer - name:094609_F_cDNA_Insig1, sequence:CTAGCAGTTTTGTGTCAGTGCC; Reverse Primer - name:094609_N_SP6_cDNA_Insig1, sequence:GCAAGTTAGGTCCCACGTGTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11955 same embryo
 EMAGE:11958 same embryo
 EMAGE:11957 same embryo
 EMAGE:11956 same embryo
 EurExpress:euxassay_011040 same experiment
 MGI:4825601 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS