Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11991

Lama5 laminin, alpha 5 ( MGI:105382)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11991 EMAGE:11991 EMAGE:11991 EMAGE:11991 EMAGE:11991
"Pseudo-wholemount" of euxassay_011032. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011032_01 euxassay_011032_02 euxassay_011032_03 euxassay_011032_04
EMAGE:11991 EMAGE:11991 EMAGE:11991 EMAGE:11991 EMAGE:11991
euxassay_011032_05 euxassay_011032_06 euxassay_011032_07 euxassay_011032_08 euxassay_011032_09
EMAGE:11991 EMAGE:11991 EMAGE:11991 EMAGE:11991 EMAGE:11991
euxassay_011032_10 euxassay_011032_11 euxassay_011032_12 euxassay_011032_13 euxassay_011032_14
EMAGE:11991 EMAGE:11991 EMAGE:11991 EMAGE:11991 EMAGE:11991
euxassay_011032_15 euxassay_011032_16 euxassay_011032_17 euxassay_011032_18 euxassay_011032_19
EMAGE:11991 EMAGE:11991 EMAGE:11991 EMAGE:11991 EMAGE:11991
euxassay_011032_20 euxassay_011032_21 euxassay_011032_22 euxassay_011032_23 euxassay_011032_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11991Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11991_wholemount_strong.wlz
11991_wholemount_moderate.wlz
11991_wholemount_weak.wlz
11991_wholemount_possible.wlz
11991_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11991_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
sublingual gland primordium
strong strong
regionalstrong expression: see section 11 17
submandibular gland primordium
strong strong
regionalstrong expression: see section 09 10 18 19 moderate expression: see section 08 20
thyroid gland
weak weak
regionalweak expression: see section 10 11 12 15 16
pituitary gland
moderate moderate
regionalmoderate expression: see section 13 14 15 weak expression: see section 12 16
epidermis
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vibrissa
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 22 23 24
lateral ventricle choroid plexus
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20
metencephalon part of 4th ventricle choroid plexus
weak weak
regionalweak expression: see section 05 06 09 10 11 13 14 15 16 17 18 19
saccule
moderate moderate
regionalmoderate expression: see section 05 06 18 19 20 21
cochlea
moderate moderate
regionalmoderate expression: see section 05 06 07 09 17 18 19 20 21 22
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 02 03 05 06 23 24 moderate expression: see section 07 09 20 21 22 weak expression: see section 08
cornea epithelium
moderate moderate
regionalmoderate expression: see section 05 24 weak expression: see section 01 02 03 04
optic stalk
weak weak
regionalweak expression: see section 01
naris
moderate moderate
regionalmoderate expression: see section 17 18 weak expression: see section 13 14 15
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 17 18 weak expression: see section 09 10 11 12 13 14 16 19 20
esophagus
strong strong
regionalstrong expression: see section 13 moderate expression: see section 12
stomach
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 weak expression: see section 08 09
hindgut
weak weak
regionalweak expression: see section 13 14
rectum
weak weak
regionalweak expression: see section 13 14
midgut
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
lower jaw incisor
strong strong
regionalstrong expression: see section 13 17 moderate expression: see section 14 18
lower jaw molar
strong strong
regionalstrong expression: see section 21 moderate expression: see section 07 08 20
oral epithelium
strong strong
regionalstrong expression: see section 09 12 13 17 21 moderate expression: see section 06 07 08 10 11 14 18 19 20 22 23 weak expression: see section 15 16
upper jaw incisor
strong strong
regionalstrong expression: see section 13 17 moderate expression: see section 14 18
upper jaw molar
strong strong
regionalstrong expression: see section 21 moderate expression: see section 07
urinary system
weak weak
regionalweak expression: see section 05 06 21 22 23
bladder
moderate moderate
regionalExpression in the fundus region.
kidney calyx
moderate moderate
regionalmoderate expression: see section 09 17 18 19 20 weak expression: see section 07 08 21
kidney pelvis
moderate moderate
regionalmoderate expression: see section 09 17 18 19
male reproductive system
moderate moderate
regionalmoderate expression: see section 13 14
urethra of male
strong strong
regionalstrong expression: see section 13 moderate expression: see section 14
larynx
strong strong
regionalstrong expression: see section 13 moderate expression: see section 14
lung
strong strong
regionalstrong expression: see section 05 06 07 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 moderate expression: see section 08 weak expression: see section 03 04
trachea
moderate moderate
regionalmoderate expression: see section 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36578
Entity Detected:Lama5, laminin, alpha 5 ( MGI:105382)
Sequence:sense strand is shown

>T36578
CTCCGTTTTATGAACCAAGAGGTGGAAACTCAAAGGGTCTTTGCTGATGGTGCTCCTCACTATGTTGCCT
TCTATAGCAATGTCACAGGGGTATGGCTGTATGTGGATGACCAGCTACAACTAGTAAAGTCTCATGAGAG
AACAACTCCCATGCTCCAACTACAGCCCGAGGAACCCTCACGGCTTCTCCTGGGAGGCCTGCCTGTGTCT
GGTACCTTCCACAACTTCAGTGGCTGCATCAGCAATGTTTTTGTACAGCGACTTCGGGGACCACAGCGTG
TGTTTGACCTACACCAGAACATGGGGAGTGTCAATGTAAGCGTAGGCTGTACACCAGCCCAACTCATCGA
GACCTCAAGGGCCACGGCTCAGAAGGTTTCCCGCCGTAGTCGACAACCCAGCCAGGACCTTGCCTGCACG
ACACCCTGGCTCCCTGGGACTATTCAGGATGCATACCAGTTTGGGGGACCCCTGCCCAGTTACCTACAGT
TTGTGGGTATCTCTCCGTCCCACAGGAATAGGCTCCACCTCTCCATGCTTGTCCGTCCACATGCGGCTTC
CCAGGGCCTCCTGCTCTCTACAGCCCCCATGTCGGGCCGCAGCCCTTCGTTGGTACTCTTTCTAAACCAT
GGACACTTTGTCGCACAGACTGAGGGCCCTGGGCCCCGGCTCCAGGTCCAGAGTCGCCAGCACTCACGGG
CTGGCCAGTGGCACAGGGTGTCCGTCCGCTGGGGAATGCAGCAGATCCAGCTTGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 77022. Forward Primer - name:077022_F_cDNA_Lama5, sequence:CTCCGTTTTATGAACCAAGAGG; Reverse Primer - name:077022_N_SP6_cDNA_Lama5, sequence:ACAAGCTGGATCTGCTGCATT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11992 same embryo
 EMAGE:11988 same embryo
 EMAGE:11990 same embryo
 EMAGE:11993 same embryo
 EMAGE:11989 same embryo
 EurExpress:euxassay_011032 same experiment
 MGI:4825860 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS