Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12080

Hes1 hairy and enhancer of split 1 (Drosophila) ( MGI:104853)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12080 EMAGE:12080 EMAGE:12080 EMAGE:12080 EMAGE:12080
"Pseudo-wholemount" of euxassay_019489. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019489_01 euxassay_019489_02 euxassay_019489_03 euxassay_019489_04
EMAGE:12080 EMAGE:12080 EMAGE:12080 EMAGE:12080 EMAGE:12080
euxassay_019489_05 euxassay_019489_06 euxassay_019489_07 euxassay_019489_08 euxassay_019489_09
EMAGE:12080 EMAGE:12080 EMAGE:12080 EMAGE:12080 EMAGE:12080
euxassay_019489_10 euxassay_019489_11 euxassay_019489_12 euxassay_019489_13 euxassay_019489_14
EMAGE:12080 EMAGE:12080 EMAGE:12080 EMAGE:12080 EMAGE:12080
euxassay_019489_15 euxassay_019489_16 euxassay_019489_17 euxassay_019489_18 euxassay_019489_19
EMAGE:12080 EMAGE:12080 EMAGE:12080 EMAGE:12080 EMAGE:12080
euxassay_019489_20 euxassay_019489_21 euxassay_019489_22 euxassay_019489_23 euxassay_019489_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12080Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12080_wholemount_strong.wlz
12080_wholemount_moderate.wlz
12080_wholemount_weak.wlz
12080_wholemount_possible.wlz
12080_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12080_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 1 metatarsal
weak weak
regionalweak expression: see section 06 23
hindlimb digit 1 phalanx
weak weak
regionalweak expression: see section 05 06 23
hindlimb digit 2 metatarsal
weak weak
regionalweak expression: see section 06 07 22 23
hindlimb digit 2 phalanx
weak weak
regionalweak expression: see section 06 07 22 23
hindlimb digit 3 metatarsal
weak weak
regionalweak expression: see section 06 07 08 21 22 23
hindlimb digit 3 phalanx
weak weak
regionalweak expression: see section 07 08 21 22 23
hindlimb digit 4 metatarsal
weak weak
regionalweak expression: see section 07 08 21 22
hindlimb digit 4 phalanx
weak weak
regionalweak expression: see section 07 08 21 22
hindlimb digit 5 metatarsal
weak weak
regionalweak expression: see section 08 21 22
hindlimb digit 5 phalanx
weak weak
regionalweak expression: see section 08 21 22
thymus primordium
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 12 15 16
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 09 10 11 18 19 20 21
pancreas
moderate moderate
regionalmoderate expression: see section 11 12 17 18 weak expression: see section 10 16
thyroid gland
weak weak
regionalweak expression: see section 12 16 17
vibrissa
moderate moderate
regionalmoderate expression: see section 06 09 10 22 24 weak expression: see section 07 08 11
hypothalamus ventricular layer
strong strong
homogeneousstrong expression: see section 13 14 moderate expression: see section 12 15
diencephalon lateral wall ventricular layer
strong strong
homogeneousstrong expression: see section 13 14 moderate expression: see section 12 15
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 13 weak expression: see section 12 14 18 19
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21 22 23 moderate expression: see section 12 weak expression: see section 24
medulla oblongata floor plate
moderate moderate
homogeneousmoderate expression: see section 12
metencephalon floor plate
moderate moderate
homogeneousmoderate expression: see section 12
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 03 05 06 07 12 weak expression: see section 04 08
pons ventricular layer
strong strong
regionalstrong expression: see section 13 moderate expression: see section 06 07 12 weak expression: see section 08
midbrain ventricular layer
strong strong
regionalstrong expression: see section 10 11 13 14 15 moderate expression: see section 07 08 09 12 weak expression: see section 16
spinal cord floor plate
moderate moderate
regionalmoderate expression: see section 13 14 15
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 12 14 weak expression: see section 13
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 02 moderate expression: see section 03 04 05 06 07 08 09 10 19 20 21 22 23 24
cornea epithelium
moderate moderate
regionalmoderate expression: see section 05 06 weak expression: see section 03 04
neural retina
strong strong
regionalstrong expression: see section 01 02 03 05 moderate expression: see section 04 weak expression: see section 24
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 18 19 20 21 moderate expression: see section 16 17
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 17
esophagus
strong strong
regionalstrong expression: see section 13 14
stomach
strong strong
regionalstrong expression: see section 03 04 05 06 moderate expression: see section 02 09 weak expression: see section 10 11
hindgut
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 14 15 16
midgut
moderate moderate
regionalmoderate expression: see section 17 18 19 20 21 weak expression: see section 10 11 12 13 14 15 16
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 13 14 17 18 19
lower jaw molar
moderate moderate
regionalmoderate expression: see section 08 09 20 21
oral epithelium
strong strong
regionalstrong expression: see section 13 14 17 18 moderate expression: see section 07 08 09 10 11 12 15 16 19 20 21 22 23
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 14 15 18 19
upper jaw molar
moderate moderate
regionalmoderate expression: see section 08 09 20 21
metanephros
weak weak
regionalweak expression: see section 07 08 09 10 11 17 18 19 20 21 22
urethra of male
strong strong
regionalstrong expression: see section 15
larynx
strong strong
regionalstrong expression: see section 13 14 moderate expression: see section 12
lung
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
trachea
moderate moderate
regionalmoderate expression: see section 14
tail skeleton
weak weak
regionalweak expression: see section 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55073
Entity Detected:Hes1, hairy and enhancer of split 1 (Drosophila) ( MGI:104853)
Sequence:sense strand is shown

>T55073
ACACCGGACAAACCAAAGACGGCCTCTGAGCACAGAAAGTCATCAAAGCCTATCATGGAGAAGAGGCGAA
GGGCAAGAATAAATGAAAGTCTAAGCCAACTGAAAACACTGATTTTGGATGCACTTAAGAAAGATAGCTC
CCGGCATTCCAAGCTAGAGAAGGCAGACATTCTGGAAATGACTGTGAAGCACCTCCGGAACCTGCAGCGG
GCGCAGATGACCGCCGCGCTCAGCACAGACCCGAGCGTGTTGGGGAAATACCGCGCCGGCTTCAGCGAGT
GCATGAACGAGGTGACCCGCTTCCTGTCCACGTGTGAGGGCGTTAACACCGAGGTGCGCACTCGGCTGCT
GGGCCACCTGGCCAACTGCATGACCCAGATCAACGCCATGACCTACCCCGGGCAGGCGCACCCCGCCTTG
CAGGCGCCGCCGCCGCCGCCCCCGTCAGGACCTGCCGGTCCCCAGCACGCGCCATTCGCGCCGCCGCCGC
CGCCGCTTGTGCCCATCCCCGGGGGCGCGGCGCCCCCTCCCGGCAGCGCACCCTGCAAGTTGGGCAGCCA
GGCTGGAGAGGCTGCCAAGGTTTTTGGCGGCTTCCAAGTGGTGCCGGCTCCTGACGGCCAATTTGCCTTT
CTCATCCCCAACGGGGCCTTCGCTCACAGCGGCCCGGTCATCCCGGTCTACACCAGCAACAGTGGGACCT
CGGTGGGTCCTAACGCAGTGTCACCTTCCAGTGGCTCCTCGCTCACTTCGGACTCCATGTGGAGACCGTG
GCGGAACTGAGAGCCTCAGGCCACTGCTACCCGTAAAGTCCCTAGCCCACCTCTCTCTT
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:ACACCGGACAAACCAAAGAC; Reverse Primer - name:unspecified, sequence:unspecified. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4825359 same experiment
 EurExpress:euxassay_019489 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS