Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12248

Fzd9 frizzled homolog 9 (Drosophila) ( MGI:1313278)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12248 EMAGE:12248 EMAGE:12248 EMAGE:12248 EMAGE:12248
"Pseudo-wholemount" of euxassay_008309. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008309_01 euxassay_008309_02 euxassay_008309_03 euxassay_008309_04
EMAGE:12248 EMAGE:12248 EMAGE:12248 EMAGE:12248 EMAGE:12248
euxassay_008309_05 euxassay_008309_06 euxassay_008309_07 euxassay_008309_08 euxassay_008309_09
EMAGE:12248 EMAGE:12248 EMAGE:12248 EMAGE:12248 EMAGE:12248
euxassay_008309_10 euxassay_008309_11 euxassay_008309_12 euxassay_008309_13 euxassay_008309_14
EMAGE:12248 EMAGE:12248 EMAGE:12248 EMAGE:12248 EMAGE:12248
euxassay_008309_15 euxassay_008309_16 euxassay_008309_17 euxassay_008309_18 euxassay_008309_19
EMAGE:12248 EMAGE:12248 EMAGE:12248 EMAGE:12248 EMAGE:12248
euxassay_008309_20 euxassay_008309_21 euxassay_008309_22 euxassay_008309_23 euxassay_008309_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12248Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12248_wholemount_strong.wlz
12248_wholemount_moderate.wlz
12248_wholemount_weak.wlz
12248_wholemount_possible.wlz
12248_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12248_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
humerus
moderate moderate
regionalmoderate expression: see section 03 weak expression: see section 04 05 21 22 23
hindlimb digit 1 metatarsal
weak weak
regionalweak expression: see section 02 03
hindlimb digit 1 phalanx
weak weak
regionalweak expression: see section 03
hindlimb digit 2 metatarsal
weak weak
regionalweak expression: see section 02 03
hindlimb digit 3 metatarsal
weak weak
regionalweak expression: see section 02 03 04
hindlimb digit 3 phalanx
weak weak
regionalweak expression: see section 03 04
hindlimb digit 4 metatarsal
weak weak
regionalweak expression: see section 03 04
hindlimb digit 4 phalanx
weak weak
regionalweak expression: see section 04
hindlimb digit 5 metatarsal
weak weak
regionalweak expression: see section 04
tarsus
weak weak
regionalweak expression: see section 02 03
fibula
weak weak
regionalweak expression: see section 01
tibia
weak weak
regionalweak expression: see section 01
femur
moderate moderate
regionalmoderate expression: see section 07 09 weak expression: see section 08 19 20
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 18 19 weak expression: see section 10 17
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 12 13 14
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 12 13 14
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 17 18 19 20 21 moderate expression: see section 01 02 13 15 16 22 23
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 weak expression: see section 21
pons ventricular layer
strong strong
regionalstrong expression: see section 17 moderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 18 19 weak expression: see section 20
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 08 09 10 12 13 14 15 16
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13
otic capsule
strong strong
regionalstrong expression: see section 08 09 10 16 17
nasal septum
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17
mandible
moderate moderate
regionalmoderate expression: see section 13 14 15
cricoid cartilage
moderate moderate
regionalmoderate expression: see section 12 14 15
thyroid cartilage
moderate moderate
regionalmoderate expression: see section 11 12 13 14
trachea
moderate moderate
regionalmoderate expression: see section 13 14
axial skeleton cervical region
moderate moderate
regionalmoderate expression: see section 09 15 16 17 18
axial skeleton lumbar region
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17
axial skeleton sacral region
moderate moderate
regionalmoderate expression: see section 14 15
axial skeleton thoracic region
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16
not examined not examined
regionalnot examined expression: see section 14
basioccipital bone
moderate moderate
regionalmoderate expression: see section 01 02 23 24
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 01 24
exoccipital bone
moderate moderate
regionalmoderate expression: see section 02 03 04 19 20 21 23 24
temporal bone petrous part
strong strong
regionalstrong expression: see section 05 06 18 19 moderate expression: see section 01 02 03 04 20 21 22 23 24
orbito-sphenoid
strong strong
regionalstrong expression: see section 06 07 08 19 moderate expression: see section 20 21
viscerocranium
strong strong
regionalExpression in the turbinate bone.
clavicle
moderate moderate
regionalmoderate expression: see section 10 weak expression: see section 09 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35161
Entity Detected:Fzd9, frizzled homolog 9 (Drosophila) ( MGI:1313278)
Sequence:sense strand is shown

>T35161
CAATGTCTACTCCTTGGCCTTCCTGATCAGAGCGGTGGCAGGTGCACAGAGTGTGGCATGCGACCAGGAG
GCAGGGGCTCTGTATGTGATCCAGGAGGGTCTGGAAAACACAGGCTGCACCCTGGTCTTCCTGTTGCTCT
ATTATTTCGGGATGGCCAGCTCACTTTGGTGGGTGGTTTTGACTCTAACCTGGTTCCTGGCTGCAGGCAA
AAAATGGGGCCACGAGGCCATCGAGGCTCACGGCAGCTACTTCCACATGGCAGCGTGGGGCCTGCCAGCA
CTCAAAACTATCGTGGTCCTGACTCTGCGCAAGGTGGCTGGCGATGAACTGACTGGGCTCTGCTATGTAG
CCAGCATGGACCCGGCAGCCCTCACTGGCTTTGTGTTGGTACCCCTATCTTGCTACCTGGTACTGGGTAC
CAGTTTCCTCCTGACCGGTTTTGTGGCTCTCTTCCATATCCGCAAAATCATGAAGACGGGAGGCACCAAT
ACGGAGAAGCTGGAGAAGCTGATGGTCAAAATCGGAGTCTTTTCCATCCTTTACACAGTGCCGGCCACCT
GCGTCATTGTCTGCTACGTTTATGAACGCCTCAACATGGACTTCTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 79108. Forward Primer - name:079108_F_cDNA_Fzd9, sequence:CAATGTCTACTCCTTGGCCTTC; Reverse Primer - name:079108_N_SP6_cDNA_Fzd9, sequence:CAGAAGTCCATGTTGAGGCGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12246 same embryo
 EMAGE:12247 same embryo
 EurExpress:euxassay_008309 same experiment
 MGI:4824956 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS