Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12359

Cytl1 cytokine-like 1 ( MGI:2684993)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12359 EMAGE:12359 EMAGE:12359 EMAGE:12359 EMAGE:12359
"Pseudo-wholemount" of euxassay_008467. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008467_01 euxassay_008467_02 euxassay_008467_03 euxassay_008467_04
EMAGE:12359 EMAGE:12359 EMAGE:12359 EMAGE:12359 EMAGE:12359
euxassay_008467_05 euxassay_008467_06 euxassay_008467_07 euxassay_008467_08 euxassay_008467_09
EMAGE:12359 EMAGE:12359 EMAGE:12359 EMAGE:12359 EMAGE:12359
euxassay_008467_10 euxassay_008467_11 euxassay_008467_12 euxassay_008467_13 euxassay_008467_14
EMAGE:12359 EMAGE:12359 EMAGE:12359 EMAGE:12359 EMAGE:12359
euxassay_008467_15 euxassay_008467_16 euxassay_008467_17 euxassay_008467_18 euxassay_008467_19
EMAGE:12359 EMAGE:12359 EMAGE:12359 EMAGE:12359 EMAGE:12359
euxassay_008467_20 euxassay_008467_21 euxassay_008467_22 euxassay_008467_23 euxassay_008467_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12359Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12359_wholemount_strong.wlz
12359_wholemount_moderate.wlz
12359_wholemount_weak.wlz
12359_wholemount_possible.wlz
12359_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12359_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 16 17 18 19 20 21 22 23 24
humerus
strong strong
regionalstrong expression: see section 03 04 05 06 23 24
forelimb digit 1 metacarpal
strong strong
regionalstrong expression: see section 01 02
forelimb digit 1 phalanx
strong strong
regionalstrong expression: see section 01 02 03 04 05
forelimb digit 2 metacarpal
strong strong
regionalstrong expression: see section 01 02
forelimb digit 2 phalanx
strong strong
regionalstrong expression: see section 01 02 03 04 05
forelimb digit 3 phalanx
strong strong
regionalstrong expression: see section 04 05
carpus
strong strong
regionalstrong expression: see section 01
hindlimb digit 1 metatarsal
strong strong
regionalstrong expression: see section 07
hindlimb digit 1 phalanx
strong strong
regionalstrong expression: see section 08 09 10
hindlimb digit 2 metatarsal
strong strong
regionalstrong expression: see section 06 07
hindlimb digit 2 phalanx
strong strong
regionalstrong expression: see section 06 07 08 09 10
hindlimb digit 3 metatarsal
strong strong
regionalstrong expression: see section 06 07
hindlimb digit 3 phalanx
strong strong
regionalstrong expression: see section 06 07 08 09 10 23 24
hindlimb digit 4 metatarsal
strong strong
regionalstrong expression: see section 07
hindlimb digit 4 phalanx
strong strong
regionalstrong expression: see section 07 08 09 10 11 21 22 23 24
hindlimb digit 5 phalanx
strong strong
regionalstrong expression: see section 08 09 10 11 22 23 24
fibula
strong strong
regionalstrong expression: see section 01 02 03 04 05
tibia
strong strong
regionalstrong expression: see section 01 02 03 04 05
femur
strong strong
regionalstrong expression: see section 02 03 04 08 09 10 23
otic capsule
strong strong
regionalstrong expression: see section 07 08 09 10 11 17 18 19 20
naris
strong strong
regionalstrong expression: see section 17
nasal septum
strong strong
regionalstrong expression: see section 14
viscerocranium
strong strong
regionalExpression in the turbinate bone.
aorta
moderate moderate
regionalmoderate expression: see section 13 14 15
hyoid
moderate moderate
regionalmoderate expression: see section 11
meckel's cartilage
strong strong
regionalstrong expression: see section 12 13 14 15 16
arytenoid cartilage
strong strong
regionalstrong expression: see section 12 13 14 15 16
cricoid cartilage
strong strong
regionalstrong expression: see section 13 14 15 16
thyroid cartilage
strong strong
regionalstrong expression: see section 12 13 14 15 16
trachea cartilaginous ring
strong strong
regionalstrong expression: see section 14 15
axial skeleton
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18 19 20
basioccipital bone
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
basisphenoid bone
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20
temporal bone petrous part
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 21 22 23 24
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 19 20 21 22 23 24
clavicle
strong strong
regionalstrong expression: see section 22
scapula
strong strong
regionalstrong expression: see section 03 04 06 23
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 11 12 13 19 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35666
Entity Detected:Cytl1, cytokine-like 1 ( MGI:2684993)
Sequence:sense strand is shown

>T35666
GACACTACCTCTGTTGCTGCTGCTGGTGGTGGTGGTGATAGCCTGGCCTCTGGCAGTACAGTCCGCGCCC
CCCACCTGCTACTCTCGGATGCTGACCCTGAGCCGTGAGATCATGGCAGACTTCCAGAGCCTGCAGGCTT
CAGAGCCTGAGGATTCCTGTGTGAGGTACTTGCCCCGGCTTTACCTGGACATCCATAACTACTGTGTGCT
GGCCAAGCTGAGAGACTTCGTGGCTTCTCCTCAGTGCTGGAAGATGGCCGAAGTGGACACTCTGAAGGAC
AGAGTGCGGAAGCTGTATACCATCATGAACTCCTTCTGCAGGCGGGACTTGGTATTCCTCTCAGATGACT
GCAGTGCCTTAGAAGACCCAATTCCCGAGGCCACGGGTCCTCCAGACTGGCAGAGCTAAGCAGGTGGACC
AGAAGAACAACCCAGAGGTCTGAAGCTGGGCCAGTTGTCCAGAGTTACACCCCCCACACACACACCCAGG
TCTACTTTTAGTGCCACTGTTAGACCTGCCACATGTCTCTAGCTTCTGAAACACCAGTGAGGGTCCTACC
TCTGAGCATGCTTTGTGCACAGGTTGGAAGCTCAGCTCAGCTCCTAGGTGTCTCATTGGAATGTAAGAGG
CACAAAGAGGAAAGTGCACACTGGCTTCGCTTTGGAGAGCAAGCACCTTAGGAACAGCAAAATCTCATGC
CTTTGTGACTGTTTTAATGAACTAATGGGACCACTCTTCTTTCTGGTCTCTGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 78698. Forward Primer - name:078698_F_cDNA_4930443F05Rik, sequence:GACACTACCTCTGTTGCTGCTG; Reverse Primer - name:078698_N_SP6_cDNA_4930443F05Rik, sequence:GCAGAGACCAGAAAGAAGAGTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12360 same embryo
 EMAGE:12357 same embryo
 EMAGE:12355 same embryo
 EMAGE:12356 same embryo
 EMAGE:12358 same embryo
 EurExpress:euxassay_008467 same experiment
 MGI:4824183 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS