Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12490

Angptl1 angiopoietin-like 1 ( MGI:1919963)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12490 EMAGE:12490 EMAGE:12490 EMAGE:12490 EMAGE:12490
"Pseudo-wholemount" of euxassay_011312. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011312_01 euxassay_011312_02 euxassay_011312_03 euxassay_011312_04
EMAGE:12490 EMAGE:12490 EMAGE:12490 EMAGE:12490 EMAGE:12490
euxassay_011312_05 euxassay_011312_06 euxassay_011312_07 euxassay_011312_08 euxassay_011312_09
EMAGE:12490 EMAGE:12490 EMAGE:12490 EMAGE:12490 EMAGE:12490
euxassay_011312_10 euxassay_011312_11 euxassay_011312_12 euxassay_011312_13 euxassay_011312_14
EMAGE:12490 EMAGE:12490 EMAGE:12490 EMAGE:12490 EMAGE:12490
euxassay_011312_15 euxassay_011312_16 euxassay_011312_17 euxassay_011312_18 euxassay_011312_19
EMAGE:12490 EMAGE:12490 EMAGE:12490 EMAGE:12490 EMAGE:12490
euxassay_011312_20 euxassay_011312_21 euxassay_011312_22 euxassay_011312_23 euxassay_011312_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12490Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12490_wholemount_strong.wlz
12490_wholemount_moderate.wlz
12490_wholemount_weak.wlz
12490_wholemount_possible.wlz
12490_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12490_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 09 10 11 12 13 19 moderate expression: see section 01 02 03 04 05 06 07 08 18 20 21 22 23 24
diaphragm
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17 18 19 20
peritoneal component
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 13 14 15 20 21 22 23 24
greater sac
strong strong
regionalstrong expression: see section 12
forearm mesenchyme
strong strong
regionalstrong expression: see section 01 02 03
upper arm mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 21 22 23 24
hand
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07
hindlimb digit 1 mesenchyme
strong strong
regionalstrong expression: see section 05 07 08
hindlimb digit 2 mesenchyme
strong strong
regionalstrong expression: see section 05 06 07 08 24
hindlimb digit 3 mesenchyme
strong strong
regionalstrong expression: see section 05 06 07 08 24
hindlimb digit 4 mesenchyme
strong strong
regionalstrong expression: see section 05 06 07 24
foot mesenchyme
strong strong
regionalstrong expression: see section 07
lower leg mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07
upper leg mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 21 22 23 24
otic capsule
moderate moderate
regionalmoderate expression: see section 08 09 10 11 18 19 20
naris
moderate moderate
regionalmoderate expression: see section 14 15 16 17 18
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
heart valve
weak weak
regionalweak expression: see section 14 15
esophagus
moderate moderate
regionalmoderate expression: see section 14 15
tongue muscle
strong strong
regionalstrong expression: see section 12 13 14 15 16 17 18 19
rectum
moderate moderate
regionalmoderate expression: see section 16
midgut
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18 19 20 21 22 23
lower jaw mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
upper jaw mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
trachea cartilaginous ring
moderate moderate
regionalmoderate expression: see section 15 16
axial skeleton
strong strong
regionalstrong expression: see section 09 10 11 12
basioccipital bone
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 18
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 20 21 22 23 24
sternum
strong strong
regionalstrong expression: see section 14 15 16 17 18
tail mesenchyme
strong strong
regionalstrong expression: see section 14 15 16 17 18 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37559
Entity Detected:Angptl1, angiopoietin-like 1 ( MGI:1919963)
Sequence:sense strand is shown

>T37559
TCTGCTGCATTAGAGAAGTCCACAGATAGCCCCAAGTTACATAGGTGGCCCAGCAAACTCAGTCCATTAG
TGCTGTGAAAAGAAGTTCCTTACTCCTTGGATTCACCGGTCAGAGCAAAAAACGCAGTTACCTCTGAAGT
AAAGCCGAACAAACTTCTACACTGATCTCAGAGAGCAAGGGCAAGGACGCACGTTCACGGACTCGCTTTT
TTCAACAGACAACAAAGACGCTGTGGTAGAATTTCATTTCAAAATGAAGGCTTTTGTTTGGACCCTAAGT
GTACTACTCTTCCTACTGGGCAGTGGTCATTGCAAAGGAGGACAACTCAATAAAAAAAATAACCCAAAGG
AGATATCCCCGTGCTACTGATGGGAAAGAGGAAGCAAAGAAATGTTCATATACATTCTTGGTACCTGAAC
AAAAAATAACAGGGCCAATCTGTGTCAACACCAAAGGTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 101289. Forward Primer - name:101289_F_cDNA_Angptl1, sequence:TCTGCTGCATTAGAGAAGTCCA; Reverse Primer - name:101289_N_SP6_cDNA_Angptl1, sequence:GACCTTTGGTGTTGACACAGAT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12488 same embryo
 EMAGE:12489 same embryo
 EMAGE:12487 same embryo
 EMAGE:12491 same embryo
 EurExpress:euxassay_011312 same experiment
 MGI:4823123 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS