Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12494

Unc13c unc-13 homolog C (C. elegans) ( MGI:2149021)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12494 EMAGE:12494 EMAGE:12494 EMAGE:12494 EMAGE:12494
"Pseudo-wholemount" of euxassay_011488. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011488_01 euxassay_011488_02 euxassay_011488_03 euxassay_011488_04
EMAGE:12494 EMAGE:12494 EMAGE:12494 EMAGE:12494 EMAGE:12494
euxassay_011488_05 euxassay_011488_06 euxassay_011488_07 euxassay_011488_08 euxassay_011488_09
EMAGE:12494 EMAGE:12494 EMAGE:12494 EMAGE:12494 EMAGE:12494
euxassay_011488_10 euxassay_011488_11 euxassay_011488_12 euxassay_011488_13 euxassay_011488_14
EMAGE:12494 EMAGE:12494 EMAGE:12494 EMAGE:12494 EMAGE:12494
euxassay_011488_15 euxassay_011488_16 euxassay_011488_17 euxassay_011488_18 euxassay_011488_19
EMAGE:12494 EMAGE:12494 EMAGE:12494 EMAGE:12494 EMAGE:12494
euxassay_011488_20 euxassay_011488_21 euxassay_011488_22 euxassay_011488_23 euxassay_011488_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12494Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12494_wholemount_strong.wlz
12494_wholemount_moderate.wlz
12494_wholemount_weak.wlz
12494_wholemount_possible.wlz
12494_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12494_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
interdigital region between forelimb digits 1 and 2
strong strong
regionalstrong expression: see section 23 24
interdigital region between forelimb digits 2 and 3
strong strong
regionalstrong expression: see section 01 02 22 23 24
interdigital region between hindlimb digits 1 and 2
strong strong
regionalstrong expression: see section 01
interdigital region between hindlimb digits 2 and 3
strong strong
regionalstrong expression: see section 01 02 22 23
interdigital region between hindlimb digits 3 and 4
strong strong
regionalstrong expression: see section 01 02 20 21 22 23
interdigital region between hindlimb digits 4 and 5
strong strong
regionalstrong expression: see section 01 02 20 21 22
hypothalamus mantle layer
strong strong
regionalstrong expression: see section 08 09 15 16 17
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 15 16 17 moderate expression: see section 13 14
telencephalon mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 08 09 19 20 21 22 23 24
olfactory cortex mantle layer
strong strong
regionalstrong expression: see section 09 10 11 15 16 17 moderate expression: see section 14
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 15 16 17 18 moderate expression: see section 13 14
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 11 12 15 16 17 18 19 20 moderate expression: see section 13 14
pons mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 15 16 17 18 19 moderate expression: see section 13 14
midbrain mantle layer
strong strong
regionalstrong expression: see section 11 12 moderate expression: see section 08 09 10 13 14 15 weak expression: see section 07 16 17 18 19
spinal cord mantle layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 09 10 11 15 16 17
stomach
strong strong
regionalstrong expression: see section 05 06 moderate expression: see section 03 04 07
lower jaw molar
moderate moderate
regionalmoderate expression: see section 05 20
upper jaw molar
moderate moderate
regionalmoderate expression: see section 04 05 19 20 21
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30328
Entity Detected:Unc13c, unc-13 homolog C (C. elegans) ( MGI:2149021)
Sequence:sense strand is shown

>T30328
ACCAAAGCCATCCATCCATGATGTATAGAAGTCAAAGCGAACTGCAAAGTGATGATTCAGAGGGGGCCCA
GCCCAAGTCCTGGCACAGTCGGCTAAGCATTGACCTTTCTGATAAGACTTTTAAGTTCCCCAAATTTGGA
TCTACTCTTCAGAGAGCAAAGTCAGCCCTGGAAGTGGTGTGGAACAAGAGCACACAGAGTCTCAGTGGGT
GTGAGGACAGCGGCTCTTCCTTAATGGGGAGATTTCGGACATTATCACAATCCACCGCGAACGAGTCAAG
TACCACCCTTGACTCTGATATCTACACGGAACCCTATTACTATAAAGCCGAGGAAGAGGAGGACTACTGT
GAACCAGTGGCTGACAGTGAGACAGATTATGTTGAAGTGATGGAGCAGGTCCTAGCTAAGCTAGAAAACA
GGACTAGTATCACTGAAGTAAACGAACACATTAAAGACTATGACCACCCTTCCTATGAAACTCCTTACGA
GACCCCGCAAGATGAGGGCTATGATGGGCAGGCTGATGACATCATTAGTGAAGGAGAACTGGAAACCTTA
AATGAACCAGCAGTTGAAATGGAATTAGCAGAAGATGAGAACCAAAACCTCCCTGCAGAGTCACTGGAGG
TCATGAAGCCAAAGAGAATCAGGCCTTCCTTCAAAGAAGCAGCTTTAAGGGCCTATAAGAAGCAGATGGC
AGAGCTGGAAGAGAAGATCCTGGCTGGAGATAGCAGCTCTATGGATGAAAAGGCTCGAATAGTAAGTGGC
AATGATTTGGATGCTTCCAAATTCTCCGCACTCCAGGTGTTCGGTGGGGCTGGGCGTGGACTGTATGGTA
TTGATAGCATGCCTGACCTCCGCAGGAAAAAGACATTGCCTATTGTGCGGGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5366834), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 32664. Forward Primer - name:032664_F_IRAV81-84_C11_Unc13c, sequence:ACCAAAGCCATCCATCCA; Reverse Primer - name:032664_R_SP6_IRAV81-84_C11_Unc13c, sequence:ATCCCGCACAATAGGCAA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12493 same embryo
 EMAGE:12492 same embryo
 EurExpress:euxassay_011488 same experiment
 MGI:4829097 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS