Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12552

Dynlt3 dynein light chain Tctex-type 3 ( MGI:1914367)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12552 EMAGE:12552 EMAGE:12552 EMAGE:12552 EMAGE:12552
"Pseudo-wholemount" of euxassay_011403. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011403_01 euxassay_011403_02 euxassay_011403_03 euxassay_011403_04
EMAGE:12552 EMAGE:12552 EMAGE:12552 EMAGE:12552 EMAGE:12552
euxassay_011403_05 euxassay_011403_06 euxassay_011403_07 euxassay_011403_08 euxassay_011403_09
EMAGE:12552 EMAGE:12552 EMAGE:12552 EMAGE:12552 EMAGE:12552
euxassay_011403_10 euxassay_011403_11 euxassay_011403_12 euxassay_011403_13 euxassay_011403_14
EMAGE:12552 EMAGE:12552 EMAGE:12552 EMAGE:12552 EMAGE:12552
euxassay_011403_15 euxassay_011403_16 euxassay_011403_17 euxassay_011403_18 euxassay_011403_19
EMAGE:12552 EMAGE:12552 EMAGE:12552 EMAGE:12552
euxassay_011403_20 euxassay_011403_21 euxassay_011403_22 euxassay_011403_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12552Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12552_wholemount_strong.wlz
12552_wholemount_moderate.wlz
12552_wholemount_weak.wlz
12552_wholemount_possible.wlz
12552_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12552_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
homogeneousmoderate expression: see section 11 12 13 14 15
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 10 16 17 18 weak expression: see section 08 09
pituitary gland
weak weak
regionalweak expression: see section 10 11 12 13 14 15
vibrissa
moderate moderate
regionalmoderate expression: see section 20 21 weak expression: see section 04 05 06 07 22
lateral ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 13 14 16 17 18 weak expression: see section 12 15
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 14 weak expression: see section 16
pons mantle layer
weak weak
regionalweak expression: see section 07 16 17
metencephalon part of 4th ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 05 06 07 10 11 13 14 16 17 18 19 20 21 weak expression: see section 08 09 12 15
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 19 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 17 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 16 17 18 19 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08 16
ventral grey horn
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11 12 16 17 weak expression: see section 07 08
naris
moderate moderate
regionalmoderate expression: see section 13 15
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 14 15 16 17 18
rectum
moderate moderate
regionalmoderate expression: see section 14
bladder
moderate moderate
regionalExpression in the fundus region.
urethra of male
moderate moderate
regionalmoderate expression: see section 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T853
Entity Detected:Dynlt3, dynein light chain Tctex-type 3 ( MGI:1914367)
Sequence:sense strand is shown

>T853
CCTCGAGNCTGTTGGCCTACTGGAGGCTTGCTCCGCCCCCAGGACTCAGAAAGCCACCATGGAGGGGTAC
CAACGGCCCTGCGATGAGGTTGGCTTCAATGCTGATGAAGCCCATAATATAGTCAAAGAGTGTGTTGATG
GAGTTTTGGGTGGTAACGATTATAATGAGAATAACATCAACCAATGGACTGCAAGCATAGTGGAACAGTC
TATAACACATTTGGTCAAACTGGGGAAAGCTTACAAGTACATTGTGACCTGTGCAGTGGTCCAGAGGAGC
CCGTATGGATTTCACACAGCCAGCTCCTGTTTTTGGGATACAACATCTGATGGAACCTGTACCATCAGAT
GGGAGAACCGTACCATGAACTGCATCGTGAATGTTTTTGCAGTTGCGATTGTCCTGTAGCCTGTAATGCA
CTAAAAAATGTGTTGGGTTAAGGCCATTAACTTAAGTTTGTGAGTGTATCCTTTCTAAAAAGAGTTACAA
CTACTTATTAATGTGCTAGATGACAAGTGTGCAATATGCTTCAAAGCTATCAACAGA
Notes:The probe template was PCR amplified from IMAGE:1923051 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1923051 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12553 same embryo
 EMAGE:12550 same embryo
 EMAGE:12551 same embryo
 EurExpress:euxassay_011403 same experiment
 MGI:4824434 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS