Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12553

Vav3 vav 3 oncogene ( MGI:1888518)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12553 EMAGE:12553 EMAGE:12553 EMAGE:12553 EMAGE:12553
"Pseudo-wholemount" of euxassay_011323. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011323_01 euxassay_011323_02 euxassay_011323_03 euxassay_011323_04
EMAGE:12553 EMAGE:12553 EMAGE:12553 EMAGE:12553 EMAGE:12553
euxassay_011323_05 euxassay_011323_06 euxassay_011323_07 euxassay_011323_08 euxassay_011323_09
EMAGE:12553 EMAGE:12553 EMAGE:12553 EMAGE:12553 EMAGE:12553
euxassay_011323_10 euxassay_011323_11 euxassay_011323_12 euxassay_011323_13 euxassay_011323_14
EMAGE:12553 EMAGE:12553 EMAGE:12553 EMAGE:12553 EMAGE:12553
euxassay_011323_15 euxassay_011323_16 euxassay_011323_17 euxassay_011323_18 euxassay_011323_19
EMAGE:12553 EMAGE:12553 EMAGE:12553 EMAGE:12553 EMAGE:12553
euxassay_011323_20 euxassay_011323_21 euxassay_011323_22 euxassay_011323_23 euxassay_011323_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12553Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12553_wholemount_strong.wlz
12553_wholemount_moderate.wlz
12553_wholemount_weak.wlz
12553_wholemount_possible.wlz
12553_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12553_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hand
moderate moderate
regionalmoderate expression: see section 02 03 04
foot
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 19 20 21 22
lower leg mesenchyme
moderate moderate
regionalmoderate expression: see section 02 03 04 05 23 24
upper leg mesenchyme
moderate moderate
regionalmoderate expression: see section 02 03 04 05 19 20 21 22 23 24
thymus primordium
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
submandibular gland primordium
strong strong
regionalstrong expression: see section 17 18 19 20 moderate expression: see section 07 08 09 10 16
skin
strong strong
spottedstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vibrissa
strong strong
spottedstrong expression: see section 02 03 04 05 06 07 08 09 19 20 21 22 23
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 15 16 17 18
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
pons mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
midbrain mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
facial vii ganglion
strong strong
spottedstrong expression: see section 07 22
glossopharyngeal ix ganglion
strong strong
spottedstrong expression: see section 07 18 19
trigeminal v ganglion
strong strong
spottedstrong expression: see section 03 04 05 06 07 08 09 18 19 20 21 22
vagus x ganglion
strong strong
spottedstrong expression: see section 08 18
spinal cord mantle layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17
dorsal root ganglion
strong strong
regionalstrong expression: see section 12 13 17 18 19 moderate expression: see section 16
cochlea
strong strong
regionalstrong expression: see section 07 08 09 17 18 19
utricle
strong strong
regionalstrong expression: see section 04 05 06 07 18 19 20 21
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 02 03 22 23 24
neural retina
strong strong
spottedstrong expression: see section 02 03 22 23 24
anterior naris epithelium
strong strong
spottedstrong expression: see section 12 13 15 16
external naris epithelium
strong strong
spottedstrong expression: see section 11 12 15 16
nasal cavity olfactory epithelium
strong strong
spottedstrong expression: see section 08 09 10 11 12 13 15 16 17 18 19
heart ventricle
moderate moderate
spottedmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17
tongue epithelium
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17
stomach
strong strong
regionalstrong expression: see section 05 06 07 moderate expression: see section 02 03 04
midgut
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 17 18 19
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 13 16 17
lower jaw molar
moderate moderate
regionalmoderate expression: see section 07 19
oral epithelium
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 16
upper jaw molar
moderate moderate
regionalmoderate expression: see section 07 19
liver
strong strong
spottedstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
bladder
moderate moderate
regionalmoderate expression: see section 13
kidney calyx
strong strong
regionalstrong expression: see section 09 10 11 12 16 17 18 19 20 21 22
kidney pelvis
strong strong
regionalstrong expression: see section 10
ureter
strong strong
regionalstrong expression: see section 17 18 19
larynx
strong strong
regionalstrong expression: see section 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T962
Entity Detected:Vav3, vav 3 oncogene ( MGI:1888518)
Sequence:sense strand is shown

>T962
TCCTCGAGNCTGTTGGCCTACTGGATTACAGTATCAGTTAAGAAAACAAAGCGGCAGTGTTCTTGCTACT
CCGAGGAGGACGAGCTAAGGCTGCTAACCAAACCAAAGGACCGCACTGACTGACCATGCCAATTTTTACC
TTTGTTTCAGAACAAGGGCCATTCAAACCACCAGAGAAACGGACCAATGGACTTCGGAGAGCTTCCAGAC
AGGTGGACCCAGGTTTGCCGAAGATGCAGGTCATTAGGAACTACACTGGCACCCCGGCCCCAGGGCTTCA
TGAAGGACCACCATTGCATATCCAGGCAGGCGACACTGTTGAACTTCTGAGAGGAGATGCACACAGTGTG
TTCTGGCAGGGACGAAACTTAGCTTCAGGAGAGGTTGGATTTTTCCCAAGTGATGCTGTCAAACCCTCTC
CATGTGTACCTAAACCAGTAGATTATTCTTGCCAACCCTGGTATGCTGGCCCAATGGAAAGATTGCAGGC
AGAAACTGAACTTATTAACAGGGTGAATAGTACTTACCTTGTAAGGCACAGGACCAAAGAATC
Notes:The probe template was PCR amplified from IMAGE:1970757 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1970757 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12550 same embryo
 EMAGE:12551 same embryo
 EMAGE:12552 same embryo
 EurExpress:euxassay_011323 same experiment
 MGI:4829153 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS