Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12594

Sned1 sushi, nidogen and EGF-like domains 1 ( MGI:3045960)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12594 EMAGE:12594 EMAGE:12594 EMAGE:12594 EMAGE:12594
"Pseudo-wholemount" of euxassay_011401. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011401_01 euxassay_011401_02 euxassay_011401_03 euxassay_011401_04
EMAGE:12594 EMAGE:12594 EMAGE:12594 EMAGE:12594 EMAGE:12594
euxassay_011401_05 euxassay_011401_06 euxassay_011401_07 euxassay_011401_08 euxassay_011401_09
EMAGE:12594 EMAGE:12594 EMAGE:12594 EMAGE:12594 EMAGE:12594
euxassay_011401_10 euxassay_011401_11 euxassay_011401_12 euxassay_011401_13 euxassay_011401_14
EMAGE:12594 EMAGE:12594 EMAGE:12594 EMAGE:12594 EMAGE:12594
euxassay_011401_15 euxassay_011401_16 euxassay_011401_17 euxassay_011401_18 euxassay_011401_19
EMAGE:12594 EMAGE:12594 EMAGE:12594 EMAGE:12594 EMAGE:12594
euxassay_011401_20 euxassay_011401_21 euxassay_011401_22 euxassay_011401_23 euxassay_011401_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12594Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12594_wholemount_strong.wlz
12594_wholemount_moderate.wlz
12594_wholemount_weak.wlz
12594_wholemount_possible.wlz
12594_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12594_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
forelimb digit 1 mesenchyme
strong strong
regionalstrong expression: see section 04 05 06
forelimb digit 2 mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06
forelimb digit 3 mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04
hindlimb digit 1 mesenchyme
strong strong
regionalstrong expression: see section 04 05 06 22 23 24
hindlimb digit 2 mesenchyme
strong strong
regionalstrong expression: see section 03 04 05 06 07 21 22 23 24
hindlimb digit 3 mesenchyme
strong strong
regionalstrong expression: see section 03 04 05 06 07 20 21 22 23 24
hindlimb digit 4 mesenchyme
strong strong
regionalstrong expression: see section 04 05 06 07 20 21 22 23
hindlimb digit 5 mesenchyme
strong strong
regionalstrong expression: see section 05 06 07 20 21 22
interdigital region between hindlimb digits 1 and 2
strong strong
regionalstrong expression: see section 06
interdigital region between hindlimb digits 2 and 3
strong strong
regionalstrong expression: see section 06
interdigital region between hindlimb digits 3 and 4
strong strong
regionalstrong expression: see section 06
interdigital region between hindlimb digits 4 and 5
strong strong
regionalstrong expression: see section 06
foot mesenchyme
strong strong
regionalstrong expression: see section 03
adrenal cortex
weak weak
regionalweak expression: see section 11 12 13 20 21 22 23
spleen primordium
strong strong
regionalstrong expression: see section 05 06 07 moderate expression: see section 08
thymus primordium
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 18 19 20 21
pancreas
moderate moderate
regionalmoderate expression: see section 10 11 12 13 17 18
vibrissa
weak weak
regionalweak expression: see section 04 05 06 20 21 22
diencephalon meninges
strong strong
regionalstrong expression: see section 06 07 08 11 12 13 14 15 16 17 moderate expression: see section 09 10 18 19
lateral ventricle choroid plexus
strong strong
regionalstrong expression: see section 14 15 16 moderate expression: see section 17 18 19 20 weak expression: see section 06 07 08 09
telencephalon meninges
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 11 12 13 14 15 16 17 20 23 24 moderate expression: see section 09 10 18 19 21 22
hindbrain meninges
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 11 12 13 14 15 16 17 20 23 moderate expression: see section 09 10 18 19 21 22
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 13 14 15 16 moderate expression: see section 11 12 17 18 19 20 weak expression: see section 06 07 08 09 10
midbrain meninges
strong strong
regionalstrong expression: see section 05 06 07 08 11 12 13 14 15 16 17 20 moderate expression: see section 09 10 18 19 21
spinal cord meninges
strong strong
regionalstrong expression: see section 12 13 14 15 16 17 20 moderate expression: see section 18 19 21
cochlea
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 18 19 20 21 22
extrinsic ocular muscle
strong strong
regionalstrong expression: see section 04 05 06 20 21 22 weak expression: see section 23 24
nasal septum
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 weak expression: see section 10
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
tongue
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17
lower lip
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 moderate expression: see section 17
upper lip
strong strong
regionalstrong expression: see section 10 11 12 14 15 16 moderate expression: see section 17
palatal shelf
strong strong
regionalstrong expression: see section 11 16 17 moderate expression: see section 12 13 15
bladder
weak weak
regionalweak expression: see section 14 15 16 17
metanephros
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 19 20 21 22 23 24
male reproductive system
weak weak
regionalweak expression: see section 13 14 18
urethra of male
weak weak
regionalweak expression: see section 14 15 16
trachea
moderate moderate
regionalmoderate expression: see section 15 16
axial skeleton tail region
strong strong
regionalstrong expression: see section 12 13 14 15 16 moderate expression: see section 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37464
Entity Detected:Sned1, sushi, nidogen and EGF-like domains 1 ( MGI:3045960)
Sequence:sense strand is shown

>T37464
CAAACATGCTGTCTCTGCTTTCTTACACAGAATAATTAAATCCCTCAAAACAGTCAGCGTCCACTTGGGA
AATGTCATAGTGGAATCAGCAAACAGACAAGGTGGAGATTTATTTTTGTGTCCAACTGAAGTAATTATGA
GTTGTTGGGCTCACCATTTGCTAATCAAAACTGAAGATGAGTAGATTACCTAATTGAGCTCACAGTTAGG
ATTCTATTCCGTTCTGATGAGTCCAAGGCCAAACACCCTACATTCAGGGAGGAGAGTGTCGATCACAAAA
AGACCACAAAATGGGAAGAGTAAGCAGCAAAGAATGGATCATTGTTCTCAAACAGCTTTGTCCACAGCCA
AGAACAGGCAGAAGGCATTCGTTCCCCTCTACTGCCTATGGGATGTGGGGTAGAGAAGATGGCTTGCTAC
GTCCTGCTTTCTGTGGAGAGTCCAACAGGCAAGGACACGCCCTTGCCAGGAATGAGCTTGCCTCACATAC
CTGCCATAGTGAGAACTGTGTGTGTGGAGGGTAGGGGTGGGGGGAGGAATCTTGGAATGATTGCTTTTCT
TTGTAAACACCCTCCTCTTTGCAGTCAGGTTCCAGGTAAGTCAAGAGCCGCCTCACCTTGGTGCTGATTC
CTCACAAAATGCACCTCAGATCCAGCAGTATCTCTGCTTTAGACAGAAATGATACATCAGGTCCATTTAC
AACACACATTAGCTGTAGTCACAGTACTTTTGTGGGCCAGGTCTTTGAGCAGTTTCTCAGCTTTGGCATT
GCTTTGTGGGCCTAATTATTCCTTATGCGGTGCAATGTACAATATTTTACAGCATCCCTGGCTCTGACCA
CAAGATCCTGAGGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 96329. Forward Primer - name:096329_F_cDNA_6720455I24Rik, sequence:CAAACATGCTGTCTCTGCTTTC; Reverse Primer - name:096329_N_SP6_cDNA_6720455I24Rik, sequence:GCCTCAGGATCTTGTGGTCAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12593 same embryo
 EMAGE:12596 same embryo
 EMAGE:12595 same embryo
 EMAGE:12591 same embryo
 EMAGE:12592 same embryo
 EurExpress:euxassay_011401 same experiment
 MGI:4828347 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS