Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12605

Mef2c myocyte enhancer factor 2C ( MGI:99458)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12605 EMAGE:12605 EMAGE:12605 EMAGE:12605 EMAGE:12605
"Pseudo-wholemount" of euxassay_011479. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011479_01 euxassay_011479_02 euxassay_011479_03 euxassay_011479_04
EMAGE:12605 EMAGE:12605 EMAGE:12605 EMAGE:12605 EMAGE:12605
euxassay_011479_05 euxassay_011479_06 euxassay_011479_07 euxassay_011479_08 euxassay_011479_09
EMAGE:12605 EMAGE:12605 EMAGE:12605 EMAGE:12605 EMAGE:12605
euxassay_011479_10 euxassay_011479_11 euxassay_011479_12 euxassay_011479_13 euxassay_011479_14
EMAGE:12605 EMAGE:12605 EMAGE:12605 EMAGE:12605 EMAGE:12605
euxassay_011479_15 euxassay_011479_16 euxassay_011479_17 euxassay_011479_18 euxassay_011479_19
EMAGE:12605 EMAGE:12605 EMAGE:12605 EMAGE:12605 EMAGE:12605
euxassay_011479_20 euxassay_011479_21 euxassay_011479_22 euxassay_011479_23 euxassay_011479_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12605Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12605_wholemount_strong.wlz
12605_wholemount_moderate.wlz
12605_wholemount_weak.wlz
12605_wholemount_possible.wlz
12605_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12605_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
strong strong
regionalstrong expression: see section 01 02 03 04 21 22 23 24
upper leg muscle
strong strong
regionalstrong expression: see section 01 02 03 04 17 18 19 20 21
rib
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 18 19 20 21 22 23 24
diaphragm
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 17 18 19 20 21 22
hand mesenchyme
strong strong
regionalstrong expression: see section 01 21 22 23 24
hindlimb digit 1 metatarsal
strong strong
regionalstrong expression: see section 20 moderate expression: see section 19
hindlimb digit 1 phalanx
strong strong
regionalstrong expression: see section 18 20
hindlimb digit 2 metatarsal
strong strong
regionalstrong expression: see section 18 moderate expression: see section 19
hindlimb digit 2 phalanx
strong strong
regionalstrong expression: see section 18 moderate expression: see section 19
hindlimb digit 3 metatarsal
strong strong
regionalstrong expression: see section 18 moderate expression: see section 19
hindlimb digit 4 metatarsal
strong strong
regionalstrong expression: see section 18
hindlimb digit 5 metatarsal
moderate moderate
regionalmoderate expression: see section 19
foot mesenchyme
strong strong
regionalstrong expression: see section 18
lower leg rest of mesenchyme
strong strong
regionalstrong expression: see section 21 22 23 24
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21 22 23 24
vibrissa
strong strong
regionalstrong expression: see section 01 02 18 19 20 moderate expression: see section 03 04 17
cerebral cortex mantle layer
strong strong
regionalstrong expression: see section 01 02 03 18 19 20 21 22 23
cerebral cortex marginal layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 16 17 18 19 20 21 22 23
telencephalon mantle layer
strong strong
regionalstrong expression: see section 01 02 03 11 14 15 16 19 20 21 23 24 moderate expression: see section 04 05 06 07 08 09 12 13 17 18
telencephalon marginal layer
strong strong
regionalstrong expression: see section 22
olfactory cortex marginal layer
strong strong
regionalstrong expression: see section 07 14 moderate expression: see section 12 13
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 17 18 19
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 08 09 10 11 12 13 14 15 16 17 18 20
glossopharyngeal ix ganglion
moderate moderate
single cellmoderate expression: see section 06 07 08 17 18
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 02 03 04 05 06 07 16 17 18 19 20 21 22
dorsal grey horn
moderate moderate
regionalmoderate expression: see section 13 14 15 weak expression: see section 10 11 12
tongue muscle
strong strong
regionalstrong expression: see section 08 09 10 11 12 13
lower lip
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
mandible
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 14 15 16 17 18 19 20
lower jaw incisor
strong strong
regionalstrong expression: see section 08 09 13
upper lip
strong strong
regionalstrong expression: see section 02 17 18 19 moderate expression: see section 03 04 05 06 07 13 14 15 16
maxilla
strong strong
regionalstrong expression: see section 02 03 04 05 06 14 15 16 17 18 19
upper jaw incisor
strong strong
regionalstrong expression: see section 07 08 09 12 13
vault of skull
strong strong
regionalstrong expression: see section 24
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 19 20 21 22 23 24 moderate expression: see section 03
clavicle
strong strong
regionalstrong expression: see section 08 09 16 17
tail mesenchyme
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 07 08 09
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30333
Entity Detected:Mef2c, myocyte enhancer factor 2C ( MGI:99458)
Sequence:sense strand is shown

>T30333
GTTCCACCTCCCAGCCTTGAGATGCCAGTTACCATCCCAGTGTCCAGCCATAACAGTTTGGTGTACAGCA
ATCCTGTCAGCACACTGGGAAACCCCAATCTTCTGCCACTGGCCCACCCGTCTCTGCAGAGGAATAGTAT
GTCTCCTGGTGTAACACATAGACCTCCAAGTGCAGGTAACACAGGCGGTCTGATGGGCGGAGATCTGACA
TCCGGTGCAGGCACCAGCGCAGGGAATGGATACGGCAACCCCCGGAACTCACCAGGCCTGCTGGTCTCAC
CTGGTAACCTGAACAAGAATATACAAGCCAAATCTCCTCCCCCTATGAATCTAGGAATGAATAATCGTAA
GCCAGATCTCCGCGTTCTTATCCCACCTGGCAGCAAGAACACGATGCCATCAGTGTCTGAGGATGTGGAT
CTGCTGTTGAATCAAAGGATAAATAACTCCCAGTCGGCTCAGTCATTGGCTACCCCGGTGGTTTCCGTAG
CAACTCCTACTTTACCAGGACAAGGAATGGGAGGATATCCATCAGCCATTTCAACAACATATGGTACTGA
GTACTCTCTGAGTAGCGCAGATCTGTCATCTCTGTCTGGCTTCAACACTGCCAGTGCGCTCCACCTCGGC
TCTGTAACTGGCTGGCAGCAGCAGCACCTACATAACATGCCGCCATCTGCCCTCAGTCAGTTGGGAGCTT
GCACTAGCACTCATTTATCTCAGAGTTCAAATCTCTCCCTGCCTTCTACTCAAAGCCTCAGCATCAAGTC
AGAACCTGTTTCTCCTCCTAGAGACCGTACCACCACCCCTTCGAGATACCCACAACACACCACGCGCCAC
GAGGCGGGGAGGTCTCCTGTTGACAGCTTGAGCAGCTGTAGCAGTTCCTACGATGGGAGCGACCGAGAGG
ATC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4500786), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 9940. Forward Primer - name:ABA_MGC_010_02_F02_F_AGAGCCCTGATGCTGACG_ABA_REV_01, sequence:GTTCCACCTCCCAGCCTT; Reverse Primer - name:_R_SP6_ABA_MGC_015_02_E12_GTTCCACCTCCCAGCCTTGAGATG, sequence:TGATCCTCTCGGTCGCTC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12606 same embryo
 EMAGE:12607 same embryo
 EurExpress:euxassay_011479 same experiment
 MGI:4826155 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS