Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12607

Trps1 trichorhinophalangeal syndrome I (human) ( MGI:1927616)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12607 EMAGE:12607 EMAGE:12607 EMAGE:12607 EMAGE:12607
"Pseudo-wholemount" of euxassay_011487. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011487_01 euxassay_011487_02 euxassay_011487_03 euxassay_011487_04
EMAGE:12607 EMAGE:12607 EMAGE:12607 EMAGE:12607 EMAGE:12607
euxassay_011487_05 euxassay_011487_06 euxassay_011487_07 euxassay_011487_08 euxassay_011487_09
EMAGE:12607 EMAGE:12607 EMAGE:12607 EMAGE:12607 EMAGE:12607
euxassay_011487_10 euxassay_011487_11 euxassay_011487_12 euxassay_011487_13 euxassay_011487_14
EMAGE:12607 EMAGE:12607 EMAGE:12607 EMAGE:12607 EMAGE:12607
euxassay_011487_15 euxassay_011487_16 euxassay_011487_17 euxassay_011487_18 euxassay_011487_19
EMAGE:12607 EMAGE:12607 EMAGE:12607 EMAGE:12607 EMAGE:12607
euxassay_011487_20 euxassay_011487_21 euxassay_011487_22 euxassay_011487_23 euxassay_011487_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12607Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12607_wholemount_strong.wlz
12607_wholemount_moderate.wlz
12607_wholemount_weak.wlz
12607_wholemount_possible.wlz
12607_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12607_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 09 10 11 15 16 17 18 19 20 21 22 23 24 moderate expression: see section 07 08
diaphragm
strong strong
regionalstrong expression: see section 13 14 15 16 17 moderate expression: see section 07 08 09 10 11 12 weak expression: see section 06
humerus
strong strong
regionalstrong expression: see section 03 04 05 21 22 23 moderate expression: see section 20
forelimb digit 1 mesenchyme
strong strong
regionalstrong expression: see section 01 02
forelimb digit 2 mesenchyme
strong strong
regionalstrong expression: see section 01 02
hindlimb digit 1 mesenchyme
strong strong
regionalstrong expression: see section 19 20
hindlimb digit 2 mesenchyme
strong strong
regionalstrong expression: see section 18 19 20
hindlimb digit 3 mesenchyme
strong strong
regionalstrong expression: see section 17 18 19
hindlimb digit 4 mesenchyme
strong strong
regionalstrong expression: see section 17 18 19
hindlimb digit 5 mesenchyme
strong strong
regionalstrong expression: see section 17 18 19
foot mesenchyme
strong strong
regionalstrong expression: see section 19 20
knee
strong strong
regionalstrong expression: see section 22 23 24
femur
strong strong
regionalstrong expression: see section 02 03 04 16 17
submandibular gland primordium
weak weak
regionalweak expression: see section 06 07 15 16 17
vibrissa
strong strong
regionalstrong expression: see section 01 02 03 16 17 18 19 20
hypothalamus ventricular layer
weak weak
regionalweak expression: see section 08 09 10 11 12 13
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 09 10 11 12 13
telencephalon mantle layer
strong strong
single cellstrong expression: see section 22 23 moderate expression: see section 01 02 03 04 16 17 19 20 21 weak expression: see section 05 06 08 15
olfactory cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 08 12 13 weak expression: see section 07
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 weak expression: see section 01 02 03 04 05 06 07
medulla oblongata basal plate mantle layer
moderate moderate
single cellmoderate expression: see section 16 18 weak expression: see section 07 08 15
medulla oblongata basal plate marginal layer
moderate moderate
single cellmoderate expression: see section 17
medulla oblongata basal plate ventricular layer
weak weak
regionalweak expression: see section 09 10 13 14 15 16
rest of cerebellum ventricular layer
weak weak
regionalweak expression: see section 08 15 16 17 18 19 20 21
pons mantle layer
moderate moderate
single cellmoderate expression: see section 17 weak expression: see section 06
pons ventricular layer
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18
midbrain mantle layer
moderate moderate
single cellmoderate expression: see section 16 17 18 weak expression: see section 07 08
midbrain ventricular layer
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16 17 18
dorsal grey horn
strong strong
single cellstrong expression: see section 09 10 11 12 13 14 15 16
ventral grey horn
strong strong
single cellstrong expression: see section 08 09 10 11 13 14 15 17
spinal cord ventricular layer
weak weak
regionalweak expression: see section 11 12 13 14
otic capsule
moderate moderate
regionalmoderate expression: see section 07 08 09 15 16 17 18
cornea
strong strong
regionalstrong expression: see section 21 22 23 moderate expression: see section 24 weak expression: see section 20
nasal septum
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12
tongue
moderate moderate
regionalmoderate expression: see section 13
tongue muscle
strong strong
regionalstrong expression: see section 08 09 10 11 12 moderate expression: see section 07
stomach
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08
midgut
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 13 14 15 16
lower lip
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
mandible
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 15 16 17 18 19 20
lower jaw molar
moderate moderate
regionalmoderate expression: see section 04 05 16 17 18
upper lip
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
maxilla
moderate moderate
regionalmoderate expression: see section 02 03 04 05 15 16 17 18
upper jaw molar
moderate moderate
regionalmoderate expression: see section 04 17 18
bladder
moderate moderate
regionalmoderate expression: see section 10 11 12 weak expression: see section 08 09
metanephros
moderate moderate
regionalmoderate expression: see section 04 05 06 07 14 15 16 17
ureter
moderate moderate
regionalmoderate expression: see section 08 weak expression: see section 07 12 13
cricoid cartilage
weak weak
regionalweak expression: see section 11 13
thyroid cartilage
weak weak
regionalweak expression: see section 10 11 12 13 14
trachea
strong strong
regionalstrong expression: see section 13 moderate expression: see section 12
axial skeleton
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18
basioccipital bone
moderate moderate
regionalmoderate expression: see section 09 10 14 15 16
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 09 10 13 14
exoccipital bone
moderate moderate
regionalmoderate expression: see section 01 04 05 06 20 21
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 09 10 11 12 13 19 20 21
clavicle
strong strong
regionalstrong expression: see section 09 10 11 13 14 15 16 17 moderate expression: see section 08
sternum
strong strong
regionalstrong expression: see section 11 12 13 14
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 05 14 15
tail mesenchyme
strong strong
regionalstrong expression: see section 10 11
axial skeleton tail region
strong strong
regionalstrong expression: see section 05 06 07 08 09 10
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30337
Entity Detected:Trps1, trichorhinophalangeal syndrome I (human) ( MGI:1927616)
Sequence:sense strand is shown

>T30337
ATCAAGCCCCTCGATTCCTCACGACAAAATGATGTGCTCCTCTTTCACTATGAGACCGTGCATGAGTCCC
AAGCATCGGATGTCAAACAGGAGGCCAACCACCTGCTAGGATCTGACGGGCAGCAGGCTGTCAGGGACAG
CAAGGAGCACTCGTGCACCAAATGCGATTTTATAACCCAGGTGGAAGAAGAGATCTCGAGACACTACAGG
AGAGCACACAGCTGCTATAAATGTCGTCAGTGCAGTTTCACAGCTGCTGACACTCAGTCACTATTGGAGC
ACTTCAACACAGTTCACTGCCAGGAACAGGAAATCACTACTGCTAATGGCGAAGAGGGTGGCCATGCCAT
ACCCACCATCAAAGAAGAGCCCAAAATTGACCTCAAGGTCTACAGTCTGCTAAACCCAGACTCTAAAATG
GGAGAAACAGTTCCCGAGAGCATAGTCAAGAGAGAGAAACTTGATGACAAGGAAGGGCTGAAAGATAAAA
TCTGGACTGAGAGTTCAACTGATGACCTTCGTGGTGTGGCTTGGAGAGGGGCAGACATCCTACGGGGTAG
TCCATCCTACACTCAAGCAAGCTTAGGGGTCTTGACGCCTGTGTCCAGCTCCCAAGAGCAGACAAAGACT
CTGAGGGACAGCCCCAATGTTGAAGCTGCCCACCTGGCACGACCTATGTATGGCTTGGCAGTAGATACCA
AGGGCTTCCTGCAAGGGGCTCCTGCTGGCAGCGAGAAGTCTGCATCTCTTACCCAGCAGTATCCTGCCTC
CGGAGAGAGCAAGACCAAGGATGAATCCCAGTCGCTGTTACGGGCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4951294), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 32919. Forward Primer - name:032919_F_IRAV81-84_H11_Trps1, sequence:ATCAAGCCCCTCGATTCC; Reverse Primer - name:032919_R_SP6_IRAV81-84_H11_Trps1, sequence:CAGCCCGTAACAGCGACT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12606 same embryo
 EMAGE:12605 same embryo
 EurExpress:euxassay_011487 same experiment
 MGI:4828940 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS