Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12617

Akap6 A kinase (PRKA) anchor protein 6 ( MGI:3050566)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12617 EMAGE:12617 EMAGE:12617 EMAGE:12617 EMAGE:12617
"Pseudo-wholemount" of euxassay_011440. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011440_01 euxassay_011440_02 euxassay_011440_03 euxassay_011440_04
EMAGE:12617 EMAGE:12617 EMAGE:12617 EMAGE:12617 EMAGE:12617
euxassay_011440_05 euxassay_011440_06 euxassay_011440_07 euxassay_011440_08 euxassay_011440_09
EMAGE:12617 EMAGE:12617 EMAGE:12617 EMAGE:12617 EMAGE:12617
euxassay_011440_10 euxassay_011440_11 euxassay_011440_12 euxassay_011440_13 euxassay_011440_14
EMAGE:12617 EMAGE:12617 EMAGE:12617 EMAGE:12617 EMAGE:12617
euxassay_011440_15 euxassay_011440_16 euxassay_011440_17 euxassay_011440_18 euxassay_011440_19
EMAGE:12617 EMAGE:12617 EMAGE:12617 EMAGE:12617 EMAGE:12617
euxassay_011440_20 euxassay_011440_21 euxassay_011440_22 euxassay_011440_23 euxassay_011440_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12617Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12617_wholemount_strong.wlz
12617_wholemount_moderate.wlz
12617_wholemount_weak.wlz
12617_wholemount_possible.wlz
12617_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12617_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 08 09 10 16 17
hindbrain meninges
strong strong
regionalstrong expression: see section 06 18 19 20 21 moderate expression: see section 07 08 09 17 weak expression: see section 10 11 15 16
pons mantle layer
weak weak
regionalweak expression: see section 07 08 18 19
midbrain mantle layer
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 21 22 23
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 07 08 19 20
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 18 19 20 21 22 23 24
vagus x ganglion
strong strong
regionalstrong expression: see section 09 18
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 07 08 18 19 20 moderate expression: see section 09
trigeminal v nerve
strong strong
regionalstrong expression: see section 18 moderate expression: see section 10
ventral grey horn
weak weak
regionalweak expression: see section 10 11 12 13 14 15
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10 11 weak expression: see section 16 17
cervical ganglion
moderate moderate
regionalmoderate expression: see section 10 17
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 12
dorsal root ganglion
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 15 16 17 18
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 24 weak expression: see section 04
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 10 11 12 13 15 16 17 weak expression: see section 18
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 12 15
tongue muscle
weak weak
regionalweak expression: see section 11 12 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37556
Entity Detected:Akap6, A kinase (PRKA) anchor protein 6 ( MGI:3050566)
Sequence:sense strand is shown

>T37556
ACTCTCACCTTGACGGAAGAAGAGCTGTGTCTCAAAGATGAGGATGACGACTCCAGTATCGCAACGGATG
ATGAAATTTATGAGGAAAGCAACCTGATGTCTGGGCTGGACTACATCAAGAACGAACTGCAGACGTGGAT
AAGACCCAAACTTTCCTTGTCGAGAGAAAAGAAACGGCCCAGTGTCACTGATGAAATAAAGGTCAATAAA
GATGGAGGAAGTACCGAGAGGGCCAATCCCTCGGACACCCTGGACATTGAGGCCCTTCTAAATTGCTCCA
TAAAACGTCTCTCTGAAAACAATGGGAATGGCAAGAACCCACCCAGAACTCATGACTTAGGAACCAAAGG
TGAAAATAAGAAAAATACGTACGACGTTACTAAAGATCCACATGTGGCCGACATGGAAAATGGCAATGTT
GAAAGTACTCCAGAGAGAGAAAAGGAGAAGCCAGAGATCCCAGAGGCATCAGCGAACCTTGCTTCAAATG
TGAAAAAGATTTCTGAATCCAAGCACGACGAGTATGAAGCATTAATGGATGGTTCTGATGATTCAAGTGT
CACTGGGAAGGAATTTGGTCCCCCAAATGATAGGCATCCTCCACAGATTGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 84021. Forward Primer - name:084021_F_cDNA_Akap6, sequence:ACTCTCACCTTGACGGAAGAAG; Reverse Primer - name:084021_N_SP6_cDNA_Akap6, sequence:CCAATCTGTGGAGGATGCCTA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12618 same embryo
 EurExpress:euxassay_011440 same experiment
 MGI:4823062 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS