Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12717

Ssr1 signal sequence receptor, alpha ( MGI:105082)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12717 EMAGE:12717 EMAGE:12717 EMAGE:12717 EMAGE:12717
"Pseudo-wholemount" of euxassay_011321. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011321_01 euxassay_011321_02 euxassay_011321_03 euxassay_011321_04
EMAGE:12717 EMAGE:12717 EMAGE:12717 EMAGE:12717 EMAGE:12717
euxassay_011321_05 euxassay_011321_06 euxassay_011321_07 euxassay_011321_08 euxassay_011321_09
EMAGE:12717 EMAGE:12717 EMAGE:12717 EMAGE:12717 EMAGE:12717
euxassay_011321_10 euxassay_011321_11 euxassay_011321_12 euxassay_011321_13 euxassay_011321_14
EMAGE:12717 EMAGE:12717 EMAGE:12717 EMAGE:12717 EMAGE:12717
euxassay_011321_15 euxassay_011321_16 euxassay_011321_17 euxassay_011321_18 euxassay_011321_19
EMAGE:12717 EMAGE:12717 EMAGE:12717 EMAGE:12717
euxassay_011321_20 euxassay_011321_21 euxassay_011321_22 euxassay_011321_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12717Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12717_wholemount_strong.wlz
12717_wholemount_moderate.wlz
12717_wholemount_weak.wlz
12717_wholemount_possible.wlz
12717_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12717_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
radius
strong strong
regionalstrong expression: see section 01
ulna
strong strong
regionalstrong expression: see section 01
humerus
strong strong
regionalstrong expression: see section 01 02 03 04 05 06
forelimb digit 5 metacarpal
strong strong
regionalstrong expression: see section 03
lower leg mesenchyme
strong strong
regionalstrong expression: see section 05 06
fibula
strong strong
regionalstrong expression: see section 01 02 03
tibia
strong strong
regionalstrong expression: see section 01 02 03
femur
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 23
submandibular gland primordium
strong strong
regionalstrong expression: see section 08 09 10 11 18 19 20 21
pancreas
strong strong
regionalstrong expression: see section 09 10 11 12 13 15 16 17 18 19
otic capsule
strong strong
regionalstrong expression: see section 07 08 09 10 16 17 18 19
naris
strong strong
regionalstrong expression: see section 14 15 16 17 18
viscerocranium
strong strong
regionalExpression in the turbinate bone.
mandible
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
lower jaw incisor
strong strong
regionalstrong expression: see section 13 14 17 18
lower jaw molar
strong strong
regionalstrong expression: see section 07 08 20 21
maxilla
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 17 18 19 20 21 22 23
upper jaw incisor
strong strong
regionalstrong expression: see section 13 14 17 18
upper jaw molar
strong strong
regionalstrong expression: see section 07 08 20 21
cricoid cartilage
strong strong
regionalstrong expression: see section 12 15 16
thyroid cartilage
strong strong
regionalstrong expression: see section 12 13 14 15 16
trachea cartilaginous ring
strong strong
regionalstrong expression: see section 14 15
basioccipital bone
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
basisphenoid bone
strong strong
regionalstrong expression: see section 12 13 14 15
temporal bone petrous part
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 20 21 22 23
vault of skull
strong strong
regionalstrong expression: see section 01 02 03 04 05
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 19 20 21 22 23
clavicle
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 17 18 19 20 21 22 23
scapula
strong strong
regionalstrong expression: see section 04 05
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 10 11 18 19
tail mesenchyme
strong strong
regionalstrong expression: see section 11 12 13 14 15 16
tail paraxial mesenchyme
strong strong
regionalstrong expression: see section 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30117
Entity Detected:Ssr1, signal sequence receptor, alpha ( MGI:105082)
Sequence:sense strand is shown

>T30117
GAAAGCGCAAGAGACCCATACAGAAAGTAGAAATGGGTACCTCAAGTCAGAATGATGTTGACATGAGCTG
GATTCCTCAGGAGACTTTGAATCAGATCAATAAAGCTTCTCCCAGAAGGCAGCCCCGGAAGCGGGCGCAG
AAGCGATCGGTGGGATCTGATGAGTAAATGTTGTGTGTGCCGCAGTGCAGCCTGTGCTTGCCCTGCCCTG
GTGTTCTCGGCCTCCTGGGAATGAGTGCAGAGAGGCCACGCCACCATAGACGCCAACTGCTGCTTATGTG
TGGACTGAGCAGTCGGAGTCTGTGGCCATACGATTGCTGAAAATGCACTGCATTGCTTTTCTAAAGTAAC
AAATTTGGGGTTTTTTTTTTTTTTTTAAAAAAAACCATTAAACTGTGTGGGTGTGGATGTCTGTGAGCAG
TTGTCTTACCAGAATCAATGTTAAACTACCTGAAACACACCTTTAGCATACTCAGCAAAACGCTCTCGCC
ACTTCCCTTATGCTAGTTTCCTGTTTTGACCCCAAGTTCAATTAATATTTTTTTCCCAGGGTGGTTTTAG
GTGAATTGTTTTGAGGGAATAATTTGTTTATTTCTTGGAATCGATCAAATCCAAACTGAGGGCACAAGCC
GGCCTTCTGCTTGCTGTCTGTCCCAGCTTGTATCTAACTGCACAGCAGGGGTGGCTGCTGTGAGCATCAG
AGGCATGCTGGGTAGTTTCTGCTGTCTGCTGTGTGCACCCTTCAGGAACTTAACAATGGAGTCAAGGAAT
TTTGGAATCACTAGCAACAAAATAGTGAAGCCTGACAATTCTACTGACACTAGTATATAAATCTTAATTC
TATGCCTGTTTTTGTTTGGTTTTTAACAAAGAATTGTCTGTCTGTGCAGACTGGACTGTTGGGTTGTCCA
TTGTCCACGTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4017600), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 19562. Forward Primer - name:019562_F_IRAV24-27_L17_Ssr1, sequence:GAAAGCGCAAGAGACCCA; Reverse Primer - name:019562_R_SP6_IRAV24-27_L17_Ssr1, sequence:CCACGTGGACAATGGACA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12714 same embryo
 EMAGE:12719 same embryo
 EMAGE:12718 same embryo
 EMAGE:12716 same embryo
 EMAGE:12715 same embryo
 EurExpress:euxassay_011321 same experiment
 MGI:4828456 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS