Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12720

Megf6 multiple EGF-like-domains 6 ( MGI:1919351)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12720 EMAGE:12720 EMAGE:12720 EMAGE:12720 EMAGE:12720
"Pseudo-wholemount" of euxassay_011603. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011603_01 euxassay_011603_02 euxassay_011603_03 euxassay_011603_04
EMAGE:12720 EMAGE:12720 EMAGE:12720 EMAGE:12720 EMAGE:12720
euxassay_011603_05 euxassay_011603_06 euxassay_011603_07 euxassay_011603_08 euxassay_011603_09
EMAGE:12720 EMAGE:12720 EMAGE:12720 EMAGE:12720 EMAGE:12720
euxassay_011603_10 euxassay_011603_11 euxassay_011603_12 euxassay_011603_13 euxassay_011603_14
EMAGE:12720 EMAGE:12720 EMAGE:12720 EMAGE:12720 EMAGE:12720
euxassay_011603_15 euxassay_011603_16 euxassay_011603_17 euxassay_011603_18 euxassay_011603_19
EMAGE:12720 EMAGE:12720 EMAGE:12720 EMAGE:12720 EMAGE:12720
euxassay_011603_20 euxassay_011603_21 euxassay_011603_22 euxassay_011603_23 euxassay_011603_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12720Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12720_wholemount_strong.wlz
12720_wholemount_moderate.wlz
12720_wholemount_weak.wlz
12720_wholemount_possible.wlz
12720_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12720_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
pericardial cavity
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
peritoneal component
moderate moderate
regionalmoderate expression: see section 01 weak expression: see section 02 03 04 05 06 07 08 09 10 11 14 15 16 19 20 21 22 23 24
pleural cavity
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 14 15 16 17 18 19 20 21 22
forearm rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02
hand mesenchyme
moderate moderate
regionalmoderate expression: see section 03
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 03 04 21 22 23
lower leg rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02
head mesenchyme
moderate moderate
regionalmoderate expression: see section 05 06 07 08 20 weak expression: see section 02 03 04 21 22 23 24
trunk mesenchyme
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 17 18 19 20 weak expression: see section 02 03 04 21 22 23 24
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 18 19 20 21
vibrissa
strong strong
regionalstrong expression: see section 08 09 10 11 21 22 23 moderate expression: see section 05 weak expression: see section 06 07 24
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 22 23 24
tongue
weak weak
regionalweak expression: see section 12 13 14 15 16 17
axial skeleton
moderate moderate
regionalmoderate expression: see section 12 13 14
exoccipital bone
strong strong
regionalstrong expression: see section 01 moderate expression: see section 02 03 04 05 06 22 23 24
temporal bone
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 05 06
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 11 12 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31689
Entity Detected:Megf6, multiple EGF-like-domains 6 ( MGI:1919351)
Sequence:sense strand is shown

>T31689
CTATGGTGCTGCCTGCCTCCTGGAGTGTTCCTGTCAGAACAATGGCAGCTGTGAGCCCACCTCCGGCGCT
TGCCTCTGTGGCCCTGGCTTCTATGGTCAAGCTTGTGAAGACACCTGCCCTGCCGGCTTCCATGGATCTG
GTTGCCAGAGAGTTTGCGAGTGTCAACAGGGCGCTCCCTGTGACCCTGTCAGTGGCCGGTGCCTCTGCCC
TGCTGGCTTCCGTGGCCAGTTCTGCGAGAGGGGGTGCAAGCCAGGCTTTTTTGGAGATGGCTGCCTGCAG
CAGTGTAACTCCCCCACGGGTGTGCCCTGTGATCCCATCAGCGGCCTCTGCCTTTGCCCACCAGGGCGCG
CAGGAACCACATGTGACCTAGATTGCAGAAGAGGCCGCTTTGGGCCGGGCTGTGCCCTGCGCTGTGATTG
TGGGGGTGGGGCTGACTGCGACCCCATCAGTGGGCAGTGCCACTGTGTGGACAGCTACACGGGACCCACT
TGCCGGGAAGTGCCCACACAGCTGTCCTCTATCAGACCAGCACCCCAGCACTCCAGCAGCAAGGCCATGA
AGCACTAACTCAGAGGAACGCCCACAGAGGCCCACTACTGTGTTCCAGCCCAAGGGACCCAGGCCTCTGC
TGGTGACTAAGATAGAGGTGGCACTTTTGGATCCACACCTCTTCTGGAAAGCCATGGATTGCTGTGGACA
GCTATGGATAGTCATATAGCCACACACCCGGGCTCCATGGTCATGGGGAAGAAGGCCTCCTTTGGACACA
AGGAATCCAGGAAGTCGGCTGGGCTTCGGGCCACTGTTTACATGGGGACCCTGCAGGCTGTGCTGTGGAA
TCCTGGCCCTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4951563), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 33844. Forward Primer - name:033844_F_IRAV81-84_H10_Egfl3, sequence:CTATGGTGCTGCCTGCCT; Reverse Primer - name:033844_R_SP6_IRAV81-84_H10_Egfl3, sequence:AGAGGGCCAGGATTCCAC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12721 same embryo
 EurExpress:euxassay_011603 same experiment
 MGI:4826156 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS