Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12727

Esyt1 extended synaptotagmin-like protein 1 ( MGI:1344426)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12727 EMAGE:12727 EMAGE:12727 EMAGE:12727 EMAGE:12727
"Pseudo-wholemount" of euxassay_011456. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011456_01 euxassay_011456_02 euxassay_011456_03 euxassay_011456_04
EMAGE:12727 EMAGE:12727 EMAGE:12727 EMAGE:12727 EMAGE:12727
euxassay_011456_05 euxassay_011456_06 euxassay_011456_07 euxassay_011456_08 euxassay_011456_09
EMAGE:12727 EMAGE:12727 EMAGE:12727 EMAGE:12727 EMAGE:12727
euxassay_011456_10 euxassay_011456_11 euxassay_011456_12 euxassay_011456_13 euxassay_011456_14
EMAGE:12727 EMAGE:12727 EMAGE:12727 EMAGE:12727 EMAGE:12727
euxassay_011456_15 euxassay_011456_16 euxassay_011456_17 euxassay_011456_18 euxassay_011456_19
EMAGE:12727 EMAGE:12727 EMAGE:12727 EMAGE:12727 EMAGE:12727
euxassay_011456_20 euxassay_011456_21 euxassay_011456_22 euxassay_011456_23 euxassay_011456_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12727Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12727_wholemount_strong.wlz
12727_wholemount_moderate.wlz
12727_wholemount_weak.wlz
12727_wholemount_possible.wlz
12727_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12727_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18
diencephalon meninges
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20 21
telencephalon meninges
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 13 14 15 moderate expression: see section 10 11 12 18 19
hindbrain meninges
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
pons mantle layer
strong strong
regionalstrong expression: see section 08 09 20
midbrain meninges
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
facial vii ganglion
strong strong
regionalstrong expression: see section 06 07 21 22 23 24
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 08 09 21
trigeminal v ganglion
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 19 20 21 22 23 24
vagus x ganglion
strong strong
regionalstrong expression: see section 10 20
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 21 moderate expression: see section 08 09
trigeminal v nerve
strong strong
regionalstrong expression: see section 11 12 19
ventral grey horn
strong strong
regionalstrong expression: see section 13 18 moderate expression: see section 12 14 15 16 17
spinal cord meninges
weak weak
regionalweak expression: see section 12 13 14 15 16 17 18 19
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 12 13 19 moderate expression: see section 20
cervical ganglion
strong strong
regionalstrong expression: see section 11 19
thoracic ganglion
strong strong
regionalstrong expression: see section 15 16
dorsal root ganglion
strong strong
regionalstrong expression: see section 09 10 11 12 13 17 18 19 20 21
neural retina
strong strong
regionalstrong expression: see section 03 04 05 24
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 13 14 17 18
vomeronasal organ
weak weak
regionalweak expression: see section 14
tongue muscle
weak weak
regionalweak expression: see section 13 14 15 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30119
Entity Detected:Esyt1, extended synaptotagmin-like protein 1 ( MGI:1344426)
Sequence:sense strand is shown

>T30119
ATGGGAAAGAACGGAGCCTGAGGGCAGCGAGGCAGCTGCTGGATGACGAGGAGCGGATCACCGCAGAGAC
GCTTTATATGAGCCACCGGGAACTACCTGCCTGGGTCAGCTTCCCAGATGTGGAAAAGGCCGAATGGCTG
AACAAGATCGTGGCTCAGGTGTGGCCCTTCCTAGGCCAGTATATGGAGAAGCTTCTGGCGGAGACAGTGG
CCCCAGCTGTCCGGGGAGCTAACCCTCATCTGCAGACATTCACATTCACACGTGTGGAGCTGGGTGAAAA
GCCATTACGAATCATTGGCGTCAAAGTTCACCCTAGTCAGAGGAAAGATCAGATTCTGTTGGACTTGAAT
GTCAGCTATGTAGGTGATGTACAGATTGACGTGGAGGTGAAGAAATATTTCTGCAAAGCTGGAGTCAAGG
GCATGCAGCTCCATGGTGTCTTGCGAGTGATTCTTGAGCCACTCACAGGGGACCTTCCTATCGTGGGGGC
TGTGTCCATGTTCTTTATCAAACGCCCGACGCTTGACATCAACTGGACAGGGATGACCAACCTGCTAGAT
ATCCCAGGACTTAGCTCACTCTCTGACACCATGATCATGGACTCCATTGCTGCCTTCCTCGTGCTCCCTA
ACCGACTGTTGGTGCCCCTTGTGCCCGACCTTCAAGATGTGGCCCAGCTGCGGTCCCCACTACCCAGGGG
CATTATCCGGATTCACCTGCTGGCAGCCCGAGGTCTGAGTTCCAAGGACAAGTATGTGAAAGGCCTGATT
GAGGGCAAATCGGATCCCTACGCGCTCGTCCGTGTGGGCACCCAGACGTTCTGCAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4165946), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 9214. Forward Primer - name:ABA_MGC_014_02_F08_F_GCAACGGAGGCACAGTCT_ABA_REV_01, sequence:ATGGGAAAGAACGGAGCC; Reverse Primer - name:_R_SP6_ABA_MGC_006_02_C08_ATGGGAAAGAACGGAGCCTGAGGG, sequence:GCTGCAGAACGTCTGGGT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12729 same embryo
 EMAGE:12731 same embryo
 EMAGE:12728 same embryo
 EMAGE:12730 same embryo
 EMAGE:12732 same embryo
 EurExpress:euxassay_011456 same experiment
 MGI:4824627 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS