Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12730

Myb myeloblastosis oncogene ( MGI:97249)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12730 EMAGE:12730 EMAGE:12730 EMAGE:12730 EMAGE:12730
"Pseudo-wholemount" of euxassay_011458. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011458_01 euxassay_011458_02 euxassay_011458_03 euxassay_011458_04
EMAGE:12730 EMAGE:12730 EMAGE:12730 EMAGE:12730 EMAGE:12730
euxassay_011458_05 euxassay_011458_06 euxassay_011458_07 euxassay_011458_08 euxassay_011458_09
EMAGE:12730 EMAGE:12730 EMAGE:12730 EMAGE:12730 EMAGE:12730
euxassay_011458_10 euxassay_011458_11 euxassay_011458_12 euxassay_011458_13 euxassay_011458_14
EMAGE:12730 EMAGE:12730 EMAGE:12730 EMAGE:12730 EMAGE:12730
euxassay_011458_15 euxassay_011458_16 euxassay_011458_17 euxassay_011458_18 euxassay_011458_19
EMAGE:12730 EMAGE:12730 EMAGE:12730 EMAGE:12730 EMAGE:12730
euxassay_011458_20 euxassay_011458_21 euxassay_011458_22 euxassay_011458_23 euxassay_011458_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12730Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12730_wholemount_strong.wlz
12730_wholemount_moderate.wlz
12730_wholemount_weak.wlz
12730_wholemount_possible.wlz
12730_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12730_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
homogeneousstrong expression: see section 13 14 15 16 17 18
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 19 20 21 22 23
pancreas
weak weak
regionalweak expression: see section 10 11 12 13 14 18 19
pituitary gland
moderate moderate
single cellmoderate expression: see section 13 14 15 16 17 18
vibrissa
moderate moderate
regionalmoderate expression: see section 08 09 10 22 23
olfactory cortex ventricular layer
weak weak
homogeneousweak expression: see section 12 13 17 18
telencephalon ventricular layer
weak weak
homogeneousweak expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 16 17 18 19 20 21 22 23 24
metencephalon rest of alar plate marginal layer
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 15 16 17 19 20 21 22 23 24
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 16 17 18 19 20 21 22 23 24
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 12 13 14 16 17 18 19 weak expression: see section 11
neural retina
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 24
naris
strong strong
regionalstrong expression: see section 15 17
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 10 11 12 13 14 17 18 19 20 21
vomeronasal organ
strong strong
regionalstrong expression: see section 14 17
stomach
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11
hindgut
weak weak
regionalweak expression: see section 14 15
rectum
moderate moderate
regionalmoderate expression: see section 15
midgut
moderate moderate
regionalmoderate expression: see section 16 17 18 19 20 21 22 23 24 weak expression: see section 13 14 15
lower jaw incisor
strong strong
regionalstrong expression: see section 13 14 18 weak expression: see section 17 19
oral epithelium
strong strong
regionalstrong expression: see section 07 08 11 12 13
palatal shelf epithelium
strong strong
regionalstrong expression: see section 13 14 15 16 17 18 weak expression: see section 19
upper jaw incisor
strong strong
regionalstrong expression: see section 13 14 18 weak expression: see section 17 19
liver lobe
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
renal cortex
weak weak
regionalweak expression: see section 08 09 10 11 12 13 18 19 20 21 22 23 24
urethra of male
weak weak
regionalweak expression: see section 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30110
Entity Detected:Myb, myeloblastosis oncogene ( MGI:97249)
Sequence:sense strand is shown

>T30110
AGTCCTCCGTCAACAGCGAATATCCCTATTACCACATCGCCGAAGCACAAAACATCTCCAGTCACGTTCC
CTATCCTGTCGCATTGCATGCTAATATAGTCAACGTCCCTCAGCCGGCTGCGGCAGCCATCCAGAGACAC
TATAACGACGAAGACCCTGAGAAGGAAAAGCGAATAAAGGAGCTGGAGTTGCTCCTGATGTCAACAGAGA
ACGAGCTGAAGGGACAGCAGGCATTACCAACACAGAACCACACTTGCAGCTACCCCGGGTGGCACAGCAC
CTCCATTGTGGACCAGACCAGACCTCATGGGGATAGTGCACCTGTTTCCTGTTTGGGAGAACACCATGCC
ACCCCATCTCTGCCTGCAGATCCCGGCTCCCTACCTGAAGAAAGTGCCTCACCAGCAAGGTGCATGATCG
TCCACCAGGGCACCATTCTGGACAATGTTAAGAACCTCTTAGAATTTGCAGAAACACTCCAGTTTATAGA
TTCTTTCTTGAACACTTCCAGCAACCATGAAAGCTCGGGCTTAGATGCACCTACCTTACCCTCCACTCCT
CTCATTGGTCACAAACTGACACCATGTCGAGACCAGACTGTGAAAACCCAGAAGGAAAATTCCATCTTTA
GAACTCCAGCTATCAAAAGGTCAATCCTCGAAAGCTCTCCTCGAACTCCCACACCATTCAAACATGCCCT
TGCAGCTCAAGAAATTAAATACGGTCCCCTGAAGATGCTACCTCAGACCCCCTCCCATGCAGTGGAGGAC
CTACAAGATGTGATTAAGCAGGAATCGGATGAATCTGGAATTGTGGCTGAGTTTCAAGAGAGTGGACCAC
CGTTACTGAAAAAAATCAAGCAGGAGGTGGAGTCGCCAACTGAGAAATCGGGAAACTTCTTCTGCTCAAA
CCACTGGGCAGAGAACAGCCTGAGCACCCAGCTGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3672769), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 36605. Forward Primer - name:036605_F_IRAV24-27_C12_Myb, sequence:AGTCCTCCGTCAACAGCG; Reverse Primer - name:036605_R_SP6_IRAV24-27_C12_Myb, sequence:AACAGCTGGGTGCTCAGG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12729 same embryo
 EMAGE:12731 same embryo
 EMAGE:12728 same embryo
 EMAGE:12727 same embryo
 EMAGE:12732 same embryo
 EurExpress:euxassay_011458 same experiment
 MGI:4826524 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS