Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12746

Pdlim5 PDZ and LIM domain 5 ( MGI:1927489)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12746 EMAGE:12746 EMAGE:12746 EMAGE:12746 EMAGE:12746
"Pseudo-wholemount" of euxassay_011640. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011640_01 euxassay_011640_02 euxassay_011640_03 euxassay_011640_04
EMAGE:12746 EMAGE:12746 EMAGE:12746 EMAGE:12746 EMAGE:12746
euxassay_011640_05 euxassay_011640_06 euxassay_011640_07 euxassay_011640_08 euxassay_011640_09
EMAGE:12746 EMAGE:12746 EMAGE:12746 EMAGE:12746 EMAGE:12746
euxassay_011640_10 euxassay_011640_11 euxassay_011640_12 euxassay_011640_13 euxassay_011640_14
EMAGE:12746 EMAGE:12746 EMAGE:12746 EMAGE:12746 EMAGE:12746
euxassay_011640_15 euxassay_011640_16 euxassay_011640_17 euxassay_011640_18 euxassay_011640_19
EMAGE:12746 EMAGE:12746 EMAGE:12746 EMAGE:12746 EMAGE:12746
euxassay_011640_20 euxassay_011640_21 euxassay_011640_22 euxassay_011640_23 euxassay_011640_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12746Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12746_wholemount_strong.wlz
12746_wholemount_moderate.wlz
12746_wholemount_weak.wlz
12746_wholemount_possible.wlz
12746_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12746_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hand mesenchyme
moderate moderate
regionalmoderate expression: see section 04 05
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 04 05 06 24
submandibular gland primordium
weak weak
regionalweak expression: see section 09 10 11 18 19 20
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 12 13 14 moderate expression: see section 15
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 12 13 14 moderate expression: see section 11
lateral ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 06 07 15 16 17 18 19 weak expression: see section 08 09 10 11 20
medulla oblongata floor plate
moderate moderate
regionalmoderate expression: see section 12 13
metencephalon floor plate
moderate moderate
regionalmoderate expression: see section 12 13
metencephalon part of 4th ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 06 07 14 15 16 17 18 19 weak expression: see section 08 09 10 11 20
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13
alar columns
moderate moderate
regionalmoderate expression: see section 13
dorsal grey horn
moderate moderate
regionalmoderate expression: see section 14 15
ventral grey horn
moderate moderate
regionalmoderate expression: see section 13 14 15
esophagus
moderate moderate
regionalmoderate expression: see section 14
stomach
moderate moderate
regionalmoderate expression: see section 06 weak expression: see section 07 08 09 10 11
midgut
strong strong
regionalstrong expression: see section 15 16 17 18 moderate expression: see section 13 weak expression: see section 09 10
bladder
weak weak
regionalweak expression: see section 14 15 16
metanephros
weak weak
regionalweak expression: see section 08 09 10 11 18 19 20 21 22
urethra of male
weak weak
regionalweak expression: see section 14 15 16
trachea
moderate moderate
regionalmoderate expression: see section 14 15
axial skeleton
moderate moderate
regionalmoderate expression: see section 15 16 weak expression: see section 13
clavicle
weak weak
regionalweak expression: see section 11 18
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 14 15 16 weak expression: see section 11 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31692
Entity Detected:Pdlim5, PDZ and LIM domain 5 ( MGI:1927489)
Sequence:sense strand is shown

>T31692
GTACAGGGGCGTCTGTGGGGCCTCCCCAGCCAAGTGACCAAGACACACTTGTGCAGAGAGCGGAACACAT
TCCAGCGGGCAAGCGGACCCCCATGTGTGCCCACTGCAACCAAGTTATCAGGGGACCTTTTCTTGTGGCT
CTGGGGAAGTCCTGGCATCCAGAAGAATTTAACTGTGCTCATTGCAAAAACACAATGGCCTACATAGGCT
TTGTAGAGGAGAAGGGAGCACTGTACTGTGAGCTATGCTATGAGAAGTTCTTTGCTCCTGAATGTGGCCG
GTGCCAAAGGAAGATCCTTGGAGAAGTCATCAATGCTTTGAAGCAGACCTGGCATGTGTCCTGTTTTGTG
TGTGTGGCCTGTGGAAAACCCATTCGTAATAATGTTTTCCACTTGGAAGATGGCGAGCCCTACTGTGAGA
CAGACTACTACGCCCTTTTTGGAACAATATGTCGTGGATGTGAATTCCCCATAGAGGCTGGTGACATGTT
CCTGGAAGCTCTGGGATACACTTGGCATGATACTTGCTTTGTGTGCTCTGTGTGTTGTGAAAGTTTGGAA
GGGCAGACATTTTTCTCCAAGAAGGACAAGCCACTTTGCAAAAAACATGCTCATTCTGTGAATTTTTGAA
AATCAGTGGTTCCAGGAAAGAGAAGAAATTTGAAGAAAAAGCAAAATCAAAATTACCATTTAATTTTTAG
TTTAATATTTATATGGAGTTCTCAAATAGTAATAGCCCTGAAGGCACAGACTCCAACTTTAAAAATCAAA
TCTGAGAAAACGTTTGGTTTAGAAAGCCACAGACAGTTTGGCATTTGTTATGAATTGCCAGTATTTTCTG
CACATGAAATAGCTTTTATAAAAATCAATTTCCTGGCTATTAAGTTCATCTTAGAATAAATTAGCAAAGT
ATTACATTTTAGAATTAAAATCCCTAGCCTCTATGCTGAAATAATACTTTGTGGGGCGGGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4457868), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 33054. Forward Primer - name:033054_F_IRAV81-84_I06_1110001A05Rik, sequence:GTACAGGGGCGTCTGTGG; Reverse Primer - name:033054_R_SP6_IRAV81-84_I06_1110001A05Rik, sequence:TACCCGCCCCACAAAGTA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12745 same embryo
 EMAGE:12747 same embryo
 EurExpress:euxassay_011640 same experiment
 MGI:4827135 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS