Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12768

Tcf25 transcription factor 25 (basic helix-loop-helix) ( MGI:1914105)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12768 EMAGE:12768 EMAGE:12768 EMAGE:12768 EMAGE:12768
"Pseudo-wholemount" of euxassay_011485. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011485_01 euxassay_011485_02 euxassay_011485_03 euxassay_011485_04
EMAGE:12768 EMAGE:12768 EMAGE:12768 EMAGE:12768 EMAGE:12768
euxassay_011485_05 euxassay_011485_06 euxassay_011485_07 euxassay_011485_08 euxassay_011485_09
EMAGE:12768 EMAGE:12768 EMAGE:12768 EMAGE:12768 EMAGE:12768
euxassay_011485_10 euxassay_011485_11 euxassay_011485_12 euxassay_011485_13 euxassay_011485_14
EMAGE:12768 EMAGE:12768 EMAGE:12768 EMAGE:12768 EMAGE:12768
euxassay_011485_15 euxassay_011485_16 euxassay_011485_17 euxassay_011485_18 euxassay_011485_19
EMAGE:12768 EMAGE:12768 EMAGE:12768 EMAGE:12768 EMAGE:12768
euxassay_011485_20 euxassay_011485_21 euxassay_011485_22 euxassay_011485_23 euxassay_011485_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12768Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12768_wholemount_strong.wlz
12768_wholemount_moderate.wlz
12768_wholemount_weak.wlz
12768_wholemount_possible.wlz
12768_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12768_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 12 13 14 15
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 17 18 19 weak expression: see section 08 09 16
thyroid gland
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 15
vibrissa
moderate moderate
regionalmoderate expression: see section 05 06 07 08 19 20 21 22
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 14 moderate expression: see section 07 08 15 weak expression: see section 06
pons mantle layer
moderate moderate
regionalmoderate expression: see section 05 16
facial vii ganglion
strong strong
regionalstrong expression: see section 02 03 04 19 20
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 07 17 18
trigeminal v ganglion
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 16 17 18 19 20 21
vagus x ganglion
strong strong
regionalstrong expression: see section 08 09 17
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 05 16 17 18 moderate expression: see section 06 07
trigeminal v nerve
strong strong
regionalstrong expression: see section 08 09 16
ventral grey horn
strong strong
regionalstrong expression: see section 12 16 17 moderate expression: see section 10 14 15
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10 16
cervical ganglion
moderate moderate
regionalmoderate expression: see section 09 16
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 14 15
dorsal root ganglion
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 16 17 18 19
neural retina
strong strong
regionalstrong expression: see section 01 22 23 24
mandible
weak weak
regionalweak expression: see section 02 03 05 06 07 08 11 12 17 18 19 20 21
lower jaw incisor
weak weak
regionalweak expression: see section 15 16
lower jaw molar
weak weak
regionalweak expression: see section 19
maxilla
weak weak
regionalweak expression: see section 05 07 08 11 17 18 19 20 21
upper jaw incisor
weak weak
regionalweak expression: see section 15 16
upper jaw molar
weak weak
regionalweak expression: see section 18 19
vault of skull
moderate moderate
regionalmoderate expression: see section 23 weak expression: see section 22
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 03 20 21 23 weak expression: see section 22
clavicle
moderate moderate
regionalmoderate expression: see section 09 10 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30311
Entity Detected:Tcf25, transcription factor 25 (basic helix-loop-helix) ( MGI:1914105)
Sequence:sense strand is shown

>T30311
TCTGCTCCAGACAAGCCCCTATCATGTGGACTCCCTGCTGCAGCTCAGTGATGCCTGCCGCTTTCAAGAG
GATCAAGAGATGGCTCGAGACCTTATAGAGAGAGCCCTGTACAGCATGGAGTGTGCATTCCACCCTTTGT
TCAGTCTCACCAGTGGAACTTGCAGGCTGGATTATCGCAGACCTGAGAATAGGAGCTTCTACCTGACCCT
CTACAAGCAGATGAGTTTCTTGGAGAAACGTGGATGCCCACGTACTGCGCTGGAGTACTGCAAGCTCATC
CTGAGCCTTGAGCCAGATGAGGACCCCCTGTGCATGTTGCTGCTTATTGACCACCTGGCCTTACGGGCCC
GGAACTATGAATACCTGATTCGCCTCTTCCAGGAATGGGAGGCTCATCGGAACCTGTCCCAGCTCCCAAA
TTTTGCCTTCTCAGTTCCACTGGCCTATTTCCTTCTGAGTCAGCAAACAGACTTACCTGAGCATGAGCTC
AGCTCTGCCAGGCAACAGGCTTCCCTCCTGATACAGCAGGCACTCACCATGTTCCCTGGAGTTCTTATGC
CACTGCTGGAGTATTGCAGTGTGCGACCTGATGCCACGGTCTCAAACCACCGCTTCTTTGGGCCGGATGC
TGAGATCAGCCAGCCTCCCGCCTTGGGCCAGCTGGTGAGTCTGTACCTGGGGAGGTCACACTTTCTTTGG
AAAGAACCCGCCATTATGAGCTGGCTAGAGGAAAATGTCCATGAGGTTCTACAAGCGGTGGATGCTGGAG
ACCCTGCTGTGGAGGTCTGTGAGAACAGGCGGAAAGTGTTGTACCAGCGTGCGCCCAGAAACATCCACCG
CCACGTGATACTGTCTGAGATCAAGGAGGCTGTTGCTGCCCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3498003), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 29893. Forward Primer - name:029893_F_IRAV77-80_K18_D8Ertd325e, sequence:TCTGCTCCAGACAAGCCC; Reverse Primer - name:029893_R_SP6_IRAV77-80_K18_D8Ertd325e, sequence:TAGGGCAGCAACAGCCTC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12767 same embryo
 EMAGE:12769 same embryo
 EurExpress:euxassay_011485 same experiment
 MGI:4828636 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS