Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12785

Tmem22 transmembrane protein 22 ( MGI:2685365)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12785 EMAGE:12785 EMAGE:12785 EMAGE:12785 EMAGE:12785
"Pseudo-wholemount" of euxassay_011646. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011646_01 euxassay_011646_02 euxassay_011646_03 euxassay_011646_04
EMAGE:12785 EMAGE:12785 EMAGE:12785 EMAGE:12785 EMAGE:12785
euxassay_011646_05 euxassay_011646_06 euxassay_011646_07 euxassay_011646_08 euxassay_011646_09
EMAGE:12785 EMAGE:12785 EMAGE:12785 EMAGE:12785 EMAGE:12785
euxassay_011646_10 euxassay_011646_11 euxassay_011646_12 euxassay_011646_13 euxassay_011646_14
EMAGE:12785 EMAGE:12785 EMAGE:12785 EMAGE:12785 EMAGE:12785
euxassay_011646_15 euxassay_011646_16 euxassay_011646_17 euxassay_011646_18 euxassay_011646_19
EMAGE:12785 EMAGE:12785 EMAGE:12785
euxassay_011646_20 euxassay_011646_21 euxassay_011646_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12785Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12785_wholemount_strong.wlz
12785_wholemount_moderate.wlz
12785_wholemount_weak.wlz
12785_wholemount_possible.wlz
12785_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12785_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
interdigital region between hindlimb digits 1 and 2
weak weak
regionalweak expression: see section 01 02 21 22
interdigital region between hindlimb digits 2 and 3
weak weak
regionalweak expression: see section 01 02 21
interdigital region between hindlimb digits 3 and 4
weak weak
regionalweak expression: see section 02 20
interdigital region between hindlimb digits 4 and 5
weak weak
regionalweak expression: see section 03 20 21
submandibular gland primordium
weak weak
regionalweak expression: see section 08 09 10 18 19 20
vibrissa
weak weak
regionalweak expression: see section 03 04 05 06 07 18 19 20 21 22
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 12 weak expression: see section 07 09 13 15 16
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 08 14
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 04 05 06 07 16 17 18 19 weak expression: see section 03 08
olfactory cortex ventricular layer
weak weak
regionalweak expression: see section 13
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 01 02 04 05 06 07 17 18 19 20 21 22 weak expression: see section 03 08 09 10 12 13 14 15 16
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 10 11
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 17 18 weak expression: see section 07 08 09 12 13 14 15 16
dorsal grey horn
weak weak
regionalweak expression: see section 14 15 16 17
ventral grey horn
weak weak
regionalweak expression: see section 14 15 16 17
cochlea
strong strong
regionalstrong expression: see section 07 08 09 18 19 20 moderate expression: see section 06 21
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 22
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 13 14 15 16 17 18
vomeronasal organ
strong strong
regionalstrong expression: see section 11 14
heart ventricle
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17
tongue
weak weak
regionalweak expression: see section 10 11 12 14 15
mandible
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 18 19 20 21 22 weak expression: see section 08 09 17
lower jaw incisor
strong strong
regionalstrong expression: see section 11 12 15 16
lower jaw molar
strong strong
regionalstrong expression: see section 06 19
maxilla
moderate moderate
regionalmoderate expression: see section 18
upper jaw incisor
strong strong
regionalstrong expression: see section 10 11 15
upper jaw molar
strong strong
regionalstrong expression: see section 06 19
testis
weak weak
regionalweak expression: see section 07 08 09 21 22
trachea
weak weak
regionalweak expression: see section 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37836
Entity Detected:Tmem22, transmembrane protein 22 ( MGI:2685365)
Sequence:sense strand is shown

>T37836
GCGACTTCCAGGATTTGTTATCTGAAGAAATGGATACTTCTCCATCCAAAAAATATCCAATTAAAAAACG
GGTGAAAATCCATCCCAACACAGTCATGGTGAAATATACCTCTCATTATCCCCAACCTGGGGATGATGGG
TATGAAGAAATCAACGAAGACTATGGTAGGTTTATGGAAGAAAACCCAAAGAAAAGTCTGCTGAGTGAAA
TGAGAAGAAAAGGAAGAACTCTGTTTGGAACCATGGACACTCAGCCTTCGTCGTCAGAAGACCCAAGAGC
CAGTGGCATGGGACAGTTCCAGAGCTTTGCAGAAAAAAACATTTTTCAGTCCCGAAAAATGTGGCTAGTG
CTGTTTGGGTCTGCTTTGGCGCACGGCTGTGTGGCTCTCATCACGAGGCTCATTTCCGACCGTTCTAAAG
TTCCATCCTTAGAACTGATTTTTATCCGGTCTGTCTTACAGGTCTTGTCCGTGATAGTTGTGTGTTATTA
CCAGGAAGCGCCCTTTGGGCCCAGCGGATACAGATTACGACTTTTCTTTTATGGAGTATGCAATGTGATT
TCCATCACCTGTGCTTATACCTCCTTTTCAATAGTTCCTCCGAGCAATGGGACCACGATGTGGAGAGCCA
CCACCACCGTTTTCAGTGCCATTTTAGCCTTTCTACTTGTAGATGAGAAAATGGCGTATGTTGACATGGC
TACAGTGGTTTGCAGCATCTTAGGTGTTTGTCTTGTCATGATCCCCAACATTGCCGATGAGGACAATTCT
CTGTTAAACGCCTGGAAGGAAGCCTTCGGGTATACAATGACTGTGATGGCCGGGTTGACCACGGCGCTTT
CTATGATAGTAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 82186. Forward Primer - name:082186_F_cDNA_LOC245020, sequence:GCGACTTCCAGGATTTGTTATC; Reverse Primer - name:082186_N_SP6_cDNA_LOC245020, sequence:ATACTATCATAGAAAGCGCCGTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12784 same embryo
 EMAGE:12783 same embryo
 EurExpress:euxassay_011646 same experiment
 MGI:4828796 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS