Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12879

Nr2f2 nuclear receptor subfamily 2, group F, member 2 ( MGI:1352452)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12879 EMAGE:12879 EMAGE:12879 EMAGE:12879 EMAGE:12879
"Pseudo-wholemount" of euxassay_011662. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011662_01 euxassay_011662_02 euxassay_011662_03 euxassay_011662_04
EMAGE:12879 EMAGE:12879 EMAGE:12879 EMAGE:12879 EMAGE:12879
euxassay_011662_05 euxassay_011662_06 euxassay_011662_07 euxassay_011662_08 euxassay_011662_09
EMAGE:12879 EMAGE:12879 EMAGE:12879 EMAGE:12879 EMAGE:12879
euxassay_011662_10 euxassay_011662_11 euxassay_011662_12 euxassay_011662_13 euxassay_011662_14
EMAGE:12879 EMAGE:12879 EMAGE:12879 EMAGE:12879 EMAGE:12879
euxassay_011662_15 euxassay_011662_16 euxassay_011662_17 euxassay_011662_18 euxassay_011662_19
EMAGE:12879 EMAGE:12879 EMAGE:12879 EMAGE:12879
euxassay_011662_20 euxassay_011662_21 euxassay_011662_22 euxassay_011662_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12879Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12879_wholemount_strong.wlz
12879_wholemount_moderate.wlz
12879_wholemount_weak.wlz
12879_wholemount_possible.wlz
12879_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12879_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 1 metatarsal
moderate moderate
regionalmoderate expression: see section 04 06 weak expression: see section 05
hindlimb digit 2 metatarsal
moderate moderate
regionalmoderate expression: see section 04 06
hindlimb digit 3 metatarsal
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 05
adrenal cortex
strong strong
regionalstrong expression: see section 09 10 11 12 13 18 20 21 moderate expression: see section 19
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 19 20 21 22
vibrissa
weak weak
regionalweak expression: see section 05 06 07 23
hypothalamus mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
telencephalon mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 19 20 21 22 23
olfactory cortex mantle layer
weak weak
regionalweak expression: see section 15
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 21 22 23 moderate expression: see section 06 17 18 19 20 weak expression: see section 07 08 09 10 13
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 18 19 20 21 22 moderate expression: see section 17 weak expression: see section 10
pons mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 19 20 21 22 23
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 19 20 21 22 23
spinal cord mantle layer
strong strong
regionalstrong expression: see section 12 13 14 17 moderate expression: see section 10 11 15 16
extrinsic ocular muscle
weak weak
regionalweak expression: see section 06 07 22 23
viscerocranium
strong strong
regionalExpression in the turbinate bone.
esophagus
weak weak
regionalweak expression: see section 14 15
tongue
moderate moderate
regionalmoderate expression: see section 12 weak expression: see section 13 14 16 17 18 19
stomach
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11
lower lip
moderate moderate
regionalmoderate expression: see section 08 09 23
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 14 18
lower jaw molar
moderate moderate
regionalmoderate expression: see section 08 20
upper lip
moderate moderate
regionalmoderate expression: see section 08 23
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 13 14 17 18
upper jaw molar
moderate moderate
regionalmoderate expression: see section 08 09 20 21
metanephros
strong strong
regionalstrong expression: see section 08 09 10 11 12 18 19 20 21 22 23 moderate expression: see section 04 05 06 07
male reproductive system
weak weak
regionalweak expression: see section 13
lung
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
trachea
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31712
Entity Detected:Nr2f2, nuclear receptor subfamily 2, group F, member 2 ( MGI:1352452)
Sequence:sense strand is shown

>T31712
CACCTGGAGCGAGCTGTTCGTGTTGAATGCGGCCCAGTGCTCCATGCCCCTCCATGTCGCCCCGCTCCTT
GCCGCTGCTGGCCTGCACGCTTCACCCATGTCAGCCGACCGGGTGGTCGCTTTTATGGACCACATACGGA
TCTTCCAAGAGCAAGTGGAGAAGCTCAAGGCACTGCACGTCGACTCCGCCGAGTATAGCTGCCTCAAGGC
CATAGTCCTGTTCACCTCAGATGCCTGTGGTCTGTCTGATGTAGCCCATGTGGAAAGCTTGCAGGAAAAG
TCCCAGTGTGCTTTGGAAGAGTACGTTAGGAGCCAGTACCCCAACCAGCCAACACGGTTCGGAAAGCTCT
TGCTTCGTCTCCCTTCCCTCCGCACGGTCTCCTCCTCAGTCATAGAGCAATTGTTTTTCGTCCGTTTGGT
AGGTAAAACCCCCATCGAAACCCTCATCCGGGATATGTTACTGTCCGGCAGCAGTTTTAACTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5368085), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 60639. Forward Primer - name:060639_F_IRAV87_g05_Nr2f2, sequence:CACCTGGAGCGAGCTGTT; Reverse Primer - name:060639_R_SP6_IRAV87_g05_Nr2f2, sequence:CCAGTTAAAACTGCTGCCG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12880 same embryo
 EMAGE:12882 same embryo
 EMAGE:12878 same embryo
 EMAGE:12881 same embryo
 EMAGE:12877 same embryo
 EurExpress:euxassay_011662 same experiment
 MGI:4826784 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS