EMAGE mouse gene expression spatial database

EMAGE:13581

Mir429 microRNA 429 ( MGI:3619402)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_019173. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_019173_01	euxassay_019173_02	euxassay_019173_03	euxassay_019173_04

euxassay_019173_05	euxassay_019173_06	euxassay_019173_07	euxassay_019173_08	euxassay_019173_09

euxassay_019173_10	euxassay_019173_11	euxassay_019173_12	euxassay_019173_13	euxassay_019173_14

euxassay_019173_15	euxassay_019173_16	euxassay_019173_17	euxassay_019173_18	euxassay_019173_19

euxassay_019173_20	euxassay_019173_21	euxassay_019173_22	euxassay_019173_23	euxassay_019173_24

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

nasal cavity olfactory epithelium

moderate

regional

moderate expression: see section 09 10 11 12 13 15 16 17 18 weak expression: see section 19

vomeronasal organ

moderate

regional

moderate expression: see section 12 15

Annotation Validation:

spatial mapping by EMAGE editor, text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T70019
Entity Detected:	Mir429, microRNA 429 ( MGI:3619402)
Sequence:	sense strand is shown >T70019 TAATACTGTCTGGTAATGCCGT
Notes:	The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-429 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:	LNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:13583 same embryo
	EMAGE:13582 same embryo
	EMAGE:13580 same embryo
	EurExpress:euxassay_019173 same experiment
	MGI:4826282 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source