Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13621

Smarca4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 ( MGI:88192)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13621 EMAGE:13621 EMAGE:13621 EMAGE:13621 EMAGE:13621
"Pseudo-wholemount" of euxassay_019506. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019506_01 euxassay_019506_02 euxassay_019506_03 euxassay_019506_04
EMAGE:13621 EMAGE:13621 EMAGE:13621 EMAGE:13621 EMAGE:13621
euxassay_019506_05 euxassay_019506_06 euxassay_019506_07 euxassay_019506_08 euxassay_019506_09
EMAGE:13621 EMAGE:13621 EMAGE:13621 EMAGE:13621 EMAGE:13621
euxassay_019506_10 euxassay_019506_11 euxassay_019506_12 euxassay_019506_13 euxassay_019506_14
EMAGE:13621 EMAGE:13621 EMAGE:13621 EMAGE:13621 EMAGE:13621
euxassay_019506_15 euxassay_019506_16 euxassay_019506_17 euxassay_019506_18 euxassay_019506_19
EMAGE:13621 EMAGE:13621 EMAGE:13621 EMAGE:13621 EMAGE:13621
euxassay_019506_20 euxassay_019506_21 euxassay_019506_22 euxassay_019506_23 euxassay_019506_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13621Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13621_wholemount_strong.wlz
13621_wholemount_moderate.wlz
13621_wholemount_weak.wlz
13621_wholemount_possible.wlz
13621_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13621_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
regionalstrong expression: see section 13 14 15 moderate expression: see section 16
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 08 09 10 16 17 18 19
pancreas
weak weak
regionalweak expression: see section 10 11 16
diencephalon
strong strong
homogeneousstrong expression: see section 07 10 11 13 14 15 16 17 18 19 moderate expression: see section 08 09
vibrissa
strong strong
regionalstrong expression: see section 05 06 07 19 21 moderate expression: see section 04 20 22
telencephalon
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 10 11 13 14 15 16 17 18 19 21 22 23 24 moderate expression: see section 08 09 12 20
hindbrain
strong strong
homogeneousstrong expression: see section 03 04 05 06 07 10 11 13 14 15 16 17 18 19 21 22 23 moderate expression: see section 08 09 weak expression: see section 20
midbrain
strong strong
homogeneousstrong expression: see section 07 10 11 13 14 15 16 17 18 19 moderate expression: see section 08 09 weak expression: see section 20
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 06 21
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 19 moderate expression: see section 08 20
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 18 19 21 22 23 moderate expression: see section 20
vagus x ganglion
strong strong
regionalstrong expression: see section 09 18
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 07 18 19 moderate expression: see section 08
trigeminal v nerve
strong strong
regionalstrong expression: see section 17 moderate expression: see section 09
spinal cord
strong strong
homogeneousstrong expression: see section 11 13 14 15 16 17 18
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 11 17
cervical ganglion
strong strong
regionalstrong expression: see section 10
thoracic ganglion
strong strong
regionalstrong expression: see section 13 14
dorsal root ganglion
strong strong
regionalstrong expression: see section 09 10 11 15 17 18 19 moderate expression: see section 16
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 03 weak expression: see section 04 05 22 23 24
neural retina
strong strong
regionalstrong expression: see section 01 02 22 23 24 moderate expression: see section 03
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 14 17 18 moderate expression: see section 07 08 10 11 15 16
vomeronasal organ
strong strong
regionalstrong expression: see section 14 moderate expression: see section 11
esophagus
moderate moderate
regionalmoderate expression: see section 13 14
stomach
moderate moderate
regionalmoderate expression: see section 03 weak expression: see section 04 05 06 07 08 09 10
midgut
moderate moderate
regionalmoderate expression: see section 14 15 16 17 18 19 weak expression: see section 08 13
lower jaw incisor
strong strong
regionalstrong expression: see section 10 moderate expression: see section 11 14 15
lower jaw molar
strong strong
regionalstrong expression: see section 06 moderate expression: see section 19
upper jaw incisor
strong strong
regionalstrong expression: see section 10 moderate expression: see section 11 14 15 16
upper jaw molar
strong strong
regionalstrong expression: see section 06 moderate expression: see section 19
metanephros
strong strong
regionalstrong expression: see section 21 moderate expression: see section 08 09 10 11 17 18 19 weak expression: see section 20
testis
moderate moderate
regionalmoderate expression: see section 05 21 22 weak expression: see section 04 19 20
lung
strong strong
regionalstrong expression: see section 05 06 07 13 14 15 moderate expression: see section 08 09 10 11 17 18 19 22 23 24 weak expression: see section 16 20 21
trachea
moderate moderate
regionalmoderate expression: see section 14 15
clavicle
moderate moderate
regionalmoderate expression: see section 17 18 weak expression: see section 09 10
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55179
Entity Detected:Smarca4, SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 ( MGI:88192)
Sequence:sense strand is shown

>T55179
GCTCAGGAAGTGGCAGTGAGGAAGACTGAACCAGACATTCCTGAGTCCTGACCCCGAGGCGCTCGTCCCA
GCCAAGATGGAGTAGCCCTTAGCAGTGATGGGTAGCACCAGATGTAGTTTCGAACTTGGAGAACTGTACA
CATGCAATCTTCCACATTTTTAGGCAGAGAAGTATAGGCCTGTCTGTCGGCCCTGGCCTGGCCTCGAGTC
TCTACCAGCATTAACTGTCTAGAGAGGGGACCTCCTGGGAGCACCATCCACCTCCCCAGGCCCCAGTCAC
TGTAGCTCAGTGGATGCATGCGCGTGCCGGCCGCTCCTTGTACTGTATCTTACTGGACAGGGCCAGCTCT
CCAGGAGGCTCACAGGCCCAGCGGGTATGTCAGTGTCACTGGAGTCAGACAGTAATAAATTAAAGCAATG
ACAAGCC
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:GCTCAGGAAGTGGCAGTGA; Reverse Primer - name:unspecified, sequence:GGCTTGTCATTGCTTTAA. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13618 same embryo
 EMAGE:13623 same embryo
 EMAGE:13622 same embryo
 EMAGE:13619 same embryo
 EMAGE:13620 same embryo
 EurExpress:euxassay_019506 same experiment
 MGI:4828322 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS