Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13623

Btf3 basic transcription factor 3 ( MGI:1202875)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13623 EMAGE:13623 EMAGE:13623 EMAGE:13623 EMAGE:13623
"Pseudo-wholemount" of euxassay_019495. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019495_01 euxassay_019495_02 euxassay_019495_03 euxassay_019495_04
EMAGE:13623 EMAGE:13623 EMAGE:13623 EMAGE:13623 EMAGE:13623
euxassay_019495_05 euxassay_019495_06 euxassay_019495_07 euxassay_019495_08 euxassay_019495_09
EMAGE:13623 EMAGE:13623 EMAGE:13623 EMAGE:13623 EMAGE:13623
euxassay_019495_10 euxassay_019495_11 euxassay_019495_12 euxassay_019495_13 euxassay_019495_14
EMAGE:13623 EMAGE:13623 EMAGE:13623 EMAGE:13623 EMAGE:13623
euxassay_019495_15 euxassay_019495_16 euxassay_019495_17 euxassay_019495_18 euxassay_019495_19
EMAGE:13623 EMAGE:13623 EMAGE:13623
euxassay_019495_20 euxassay_019495_21 euxassay_019495_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13623Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13623_wholemount_strong.wlz
13623_wholemount_moderate.wlz
13623_wholemount_weak.wlz
13623_wholemount_possible.wlz
13623_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13623_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
regionalstrong expression: see section 12 16 moderate expression: see section 11 13 14 weak expression: see section 15
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 08 09 16 17 18 19
pancreas
moderate moderate
regionalmoderate expression: see section 09 10 11 weak expression: see section 12
vibrissa
moderate moderate
regionalmoderate expression: see section 05 19 20 21 weak expression: see section 06
olfactory cortex ventricular layer
weak weak
homogeneousweak expression: see section 09 15
telencephalon ventricular layer
weak weak
homogeneousweak expression: see section 02 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21 22
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 weak expression: see section 09 10 11 18
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 weak expression: see section 03 04 22
esophagus
weak weak
regionalweak expression: see section 13
hindgut
weak weak
regionalweak expression: see section 12
midgut
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 06 07 08 09 10 11 12 13 14 15 17 18
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 14 15
lower jaw molar
moderate moderate
regionalmoderate expression: see section 05 06 19 weak expression: see section 18
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 14 15
upper jaw molar
moderate moderate
regionalmoderate expression: see section 05 19
liver
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
metanephros
moderate moderate
regionalmoderate expression: see section 07 08 09 10 16 17 18 19 20 weak expression: see section 11
testis
weak weak
regionalweak expression: see section 04 05 20 21
lung
moderate moderate
regionalmoderate expression: see section 05 06 09 10 12 14 20 21 22 weak expression: see section 07 08 11 15 16 17 18 19
clavicle
moderate moderate
regionalmoderate expression: see section 10 weak expression: see section 11 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55018
Entity Detected:Btf3, basic transcription factor 3 ( MGI:1202875)
Sequence:sense strand is shown

>T55018
CCTTCTCTCAGCTGGTCTGCCCGAGACCCCCTGAGCGTGAACCTTAGTTCCCCGCGCGGCGCCATTTCCA
CTCCGACAAGGTACAGAAAAAAGGCCGTGGACGCCGGCGTGGGAGGAGACCGGGAGTTGGGGGTGGGGCG
GGCGTTTCCCGGCAGGAGCGAGGCAGGGAGGGGACGGACGGAGCTGAGGAAAGCGATGCGACGGACGGGC
GCTCCCACCCAGGCGGACTCTCGGGGGCGAGGGCGAGCCAGGGGCGGCTGGCCCGGGGCCGAAGCGACGC
CCTCTCTCCCTCTCGGCGGAAGCCGAGGACGGGAGTCTCAGATGAAAGAAACAATCATGAACCAGGAGAA
ACTCGCCAAACTGCAGGCACAAGTGCGCATTGGTGGGAAAGGAACTGCTCGTAGG
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:CCTTCTCTCAGCTGGTCTGC; Reverse Primer - name:unspecified, sequence:CCTACGAGCAGTTCCTTTCC. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13618 same embryo
 EMAGE:13622 same embryo
 EMAGE:13619 same embryo
 EMAGE:13621 same embryo
 EMAGE:13620 same embryo
 EurExpress:euxassay_019495 same experiment
 MGI:4823515 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS