Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13637

Patz1 POZ (BTB) and AT hook containing zinc finger 1 ( MGI:1891832)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13637 EMAGE:13637 EMAGE:13637 EMAGE:13637 EMAGE:13637
"Pseudo-wholemount" of euxassay_019522. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019522_01 euxassay_019522_02 euxassay_019522_03 euxassay_019522_04
EMAGE:13637 EMAGE:13637 EMAGE:13637 EMAGE:13637 EMAGE:13637
euxassay_019522_05 euxassay_019522_06 euxassay_019522_07 euxassay_019522_08 euxassay_019522_09
EMAGE:13637 EMAGE:13637 EMAGE:13637 EMAGE:13637 EMAGE:13637
euxassay_019522_10 euxassay_019522_11 euxassay_019522_12 euxassay_019522_13 euxassay_019522_14
EMAGE:13637 EMAGE:13637 EMAGE:13637 EMAGE:13637 EMAGE:13637
euxassay_019522_15 euxassay_019522_16 euxassay_019522_17 euxassay_019522_18 euxassay_019522_19
EMAGE:13637 EMAGE:13637 EMAGE:13637 EMAGE:13637 EMAGE:13637
euxassay_019522_20 euxassay_019522_21 euxassay_019522_22 euxassay_019522_23 euxassay_019522_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13637Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13637_wholemount_strong.wlz
13637_wholemount_moderate.wlz
13637_wholemount_weak.wlz
13637_wholemount_possible.wlz
13637_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13637_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
regionalstrong expression: see section 13 14 moderate expression: see section 12 15 16
submandibular gland primordium
strong strong
regionalstrong expression: see section 09 10 18 19 20 21 moderate expression: see section 08
pancreas
weak weak
regionalweak expression: see section 10 11 12 13 14
thyroid gland
moderate moderate
regionalmoderate expression: see section 12 17
pituitary gland
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16
vibrissa
moderate moderate
regionalmoderate expression: see section 07 21 22 weak expression: see section 06 08 09 20 23
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 06 21 22 23
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 09 20 weak expression: see section 08
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 09 10 19 20 21 22 23 weak expression: see section 08 18
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 19
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 09 10 19 20 21 22 weak expression: see section 08 18
trigeminal v nerve
weak weak
regionalweak expression: see section 10 18
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 11 12 18
cervical ganglion
weak weak
regionalweak expression: see section 10 18
thoracic ganglion
weak weak
regionalweak expression: see section 14 15
dorsal root ganglion
strong strong
regionalstrong expression: see section 13 17 18 19 moderate expression: see section 09 10 11 12
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 09 10 11 12 13 15 16 17 18 19 20
vomeronasal organ
weak weak
regionalweak expression: see section 13 15 16
esophagus
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 13
stomach
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 weak expression: see section 11
midgut
moderate moderate
regionalmoderate expression: see section 10 weak expression: see section 11 12 13 14 15 16 17 18 19 20
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 12 13 16 18
lower jaw molar
weak weak
regionalweak expression: see section 19 20
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 12 13 16
upper jaw molar
weak weak
regionalweak expression: see section 07 19 20
metanephros
strong strong
regionalstrong expression: see section 11 18 19 21 moderate expression: see section 08 09 10 12 20 22 23
urethra of male
weak weak
regionalweak expression: see section 14 15 16
lung
strong strong
regionalstrong expression: see section 05 06 07 09 10 11 12 19 20 21 22 23 24 moderate expression: see section 04 08 13 14 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55138
Entity Detected:Patz1, POZ (BTB) and AT hook containing zinc finger 1 ( MGI:1891832)
Sequence:sense strand is shown

>T55138
TGGCAGACCACCTGAAGAAGCACAGTGAGGGGCCCAGCAACTTCTGTAGCATCTGTAACCGAGAAGGCCA
GAAATGCTCACATCAGGATCTGATTGAGAGCTCCGACTCCTACGGTGACCTCTCCGACGCCAGCGACCTG
AAGACGCCAGAGAAACAGAGTGCCAACGGCTCCTTCTCCTGCGACGTGGCAGTCCCTAAAAACAAAATGG
AGTCTGACGGGGAGAAGAAGTACCCATGCCCTGAATGTGGGAGCTTCTTCCGTTCTAAGTCCTACTTGAA
CAAACACATCCAGAAGGTGCATGTCCGTGCCCTTGGGGGTCCCTTGGGGGACCTGGGCCCTGCCCTTGGT
TCACCTTTCTCTCCCCAGCAGAACATGTCTCTTCTTGAGTCCTTTGGATTTCAGATTGTTCAGTCAGCGT
TTGCATCATCTTTAGTGGATCCTGAGGTGGACCAGCAGCCCATGGGGCCTGAAGGGAAGTGAGACATGCT
GTGTCCCCACAGAACAGCCGCTGGGGACTGCTGAGCAATGCTGTGAATGCAGAGGGAAGTGATGTCTTTG
GGTTCTGTAGCTGAGAGATTTTTATTCATTTTTAAACCCCATCCCTGCCCCTCCCTCCCTCCATTAACCC
CACCTGCTGTGGTCTTAGAAACAGACTCTCATCTGATACTCTCTGTAGAAATACTGAGAGACCCAATATG
GGGCAAGGGCAGAAAGCACTACATCGGCCTCTGAGGCAGTACCAGTTCTGGTTTCTCTAGTGGTCTGAAG
CCAGAATTTCTGGTGCTCAGTTATTGGTGTCCTCACCCCAACTCTAAGGCACTCTTGGGCCTCGCTTGGT
AGTTTTGGTCCCTCCCACTTCTTTCATTCCTCACCCCCCTGCCTCTGTCCTCAAAAGAAGTTAAGTAGGG
TCTCTACCCTCTTATGGCC
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:TGGCAGACCACCTGAAGAAG; Reverse Primer - name:unspecified, sequence:GGCCATAAGAGGGTAGAGACC. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13639 same embryo
 EMAGE:13640 same embryo
 EMAGE:13641 same embryo
 EMAGE:13638 same embryo
 EurExpress:euxassay_019522 same experiment
 MGI:4827059 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS