Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13638

Pou3f3 POU domain, class 3, transcription factor 3 ( MGI:102564)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13638 EMAGE:13638 EMAGE:13638 EMAGE:13638 EMAGE:13638
"Pseudo-wholemount" of euxassay_019559. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019559_01 euxassay_019559_02 euxassay_019559_03 euxassay_019559_04
EMAGE:13638 EMAGE:13638 EMAGE:13638 EMAGE:13638 EMAGE:13638
euxassay_019559_05 euxassay_019559_06 euxassay_019559_07 euxassay_019559_08 euxassay_019559_09
EMAGE:13638 EMAGE:13638 EMAGE:13638 EMAGE:13638 EMAGE:13638
euxassay_019559_10 euxassay_019559_11 euxassay_019559_12 euxassay_019559_13 euxassay_019559_14
EMAGE:13638 EMAGE:13638 EMAGE:13638 EMAGE:13638 EMAGE:13638
euxassay_019559_15 euxassay_019559_16 euxassay_019559_17 euxassay_019559_18 euxassay_019559_19
EMAGE:13638 EMAGE:13638 EMAGE:13638 EMAGE:13638 EMAGE:13638
euxassay_019559_20 euxassay_019559_21 euxassay_019559_22 euxassay_019559_23 euxassay_019559_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13638Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13638_wholemount_strong.wlz
13638_wholemount_moderate.wlz
13638_wholemount_weak.wlz
13638_wholemount_possible.wlz
13638_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13638_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
forelimb digit 1 phalanx
moderate moderate
regionalmoderate expression: see section 03 weak expression: see section 02 23 24
forelimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 03 weak expression: see section 01 02
forelimb digit 3 phalanx
weak weak
regionalweak expression: see section 24
hindlimb digit 1 phalanx
weak weak
regionalweak expression: see section 03
hindlimb digit 2 phalanx
weak weak
regionalweak expression: see section 02 21 22 23
hindlimb digit 3 phalanx
weak weak
regionalweak expression: see section 02 03 21 22
hindlimb digit 4 phalanx
weak weak
regionalweak expression: see section 03 05 22
hypothalamus mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 15 16 17
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 12 13 14
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 15 16 17 18 19
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 12 13 14
telencephalon mantle layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 15 16 17 18 19 20 21 22 23 24
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 10 11 12 15 16 17 18
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 21 22 23 24
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 08 09 10 15 moderate expression: see section 11 12 16 17 18 19
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 15
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 08 09 10 13 14 15 moderate expression: see section 11 12 16 17 18
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 13 14 15 moderate expression: see section 12
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 05 06 07 14 15 20 21 22 moderate expression: see section 08 09 10 11 12 16 17 18
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 04 05 06 07 13 14 15 20 21 22 moderate expression: see section 08 09 10 11 12 16 17 18
pons mantle layer
strong strong
regionalstrong expression: see section 07 09 10 13 14 15 moderate expression: see section 11 12 16 17 18 19
pons ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10 13 14 15 moderate expression: see section 12 16 17 18 19
midbrain mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 14 15 16 17 18 19 20
midbrain ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18
trigeminal v nerve
strong strong
regionalstrong expression: see section 05 06 07 21 22 moderate expression: see section 23 24
spinal cord mantle layer
strong strong
homogeneousstrong expression: see section 13 14 15 moderate expression: see section 10 11 16 17 18 weak expression: see section 12
spinal cord ventricular layer
strong strong
homogeneousstrong expression: see section 13 14 15
inner ear
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 17 18 19 20 21 22 23 24
lower eyelid
strong strong
regionalstrong expression: see section 01 02 03 24
upper eyelid
strong strong
regionalstrong expression: see section 01 02 03 24
nasal septum
strong strong
regionalstrong expression: see section 11 12 13 15 16 17 18 moderate expression: see section 14
tongue muscle
strong strong
regionalstrong expression: see section 13 14
rectum
moderate moderate
regionalmoderate expression: see section 14 15
midgut
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 10 11 12
midgut loop
moderate moderate
regionalmoderate expression: see section 15 16 17
lower lip
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
mandible
strong strong
regionalstrong expression: see section 05 06 07 08 21 22 23 moderate expression: see section 09 19 20
upper lip
strong strong
regionalstrong expression: see section 05 06 07 20 21 22 moderate expression: see section 08
maxilla
strong strong
regionalstrong expression: see section 06 07 08 21 22 23 moderate expression: see section 19 20
palatal shelf
strong strong
regionalstrong expression: see section 15 moderate expression: see section 11 12 13 14 16 17 18
metanephros
strong strong
regionalstrong expression: see section 07 08 09 10 11 17 18 19 20 21 22
male reproductive system
moderate moderate
regionalmoderate expression: see section 15 16 weak expression: see section 14
genital tubercle of male
strong strong
regionalstrong expression: see section 13 14 15 16 17 18 weak expression: see section 12
larynx
strong strong
regionalstrong expression: see section 13 14 15 weak expression: see section 12 16
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55158
Entity Detected:Pou3f3, POU domain, class 3, transcription factor 3 ( MGI:102564)
Sequence:sense strand is shown

>T55158
GTCCAAGAAAGGAGGGACCAAAAAAATTTTTAAGCATAATAAATACCAAGACTGTTTTATATGCATATAT
AACAAACAAAACCGGAAGAGGAAAAGGGGCAACAGGGACATCTCGTTTATACTGTGGTGGTGTTCTGCTT
CTGTTTTGAAAGAAGGGTGAAGATGCCTAACGCACCTAAACTGCACACTTGAGGTACTGTCCACACCGAG
ATGTCCTGCATGGCGTCGTCGGTGGAGAACACCTGCCTCGGAGATAAGAGAGAGACACCCCCCCCCTCTT
TCTTCCACTTCTTCCAAAAGGGCTGCCTAAAAGATCCATGGAAACTTTCTTTATGGGGAGCGACCTGAAA
AGAAAGACGCACCAGGTTTCCTGCAGGTCTGACTCTGCTCTTGGACAGTGTTTTTCTTGGCCATATTCAA
GTCTTTGGGGAACAAATAAATCAACTAAGAAATGGGAAGAAGGGAGAAACAGAGTCTGGGGGGGAAGATT
CGCCGCTTCTGAAGTTCACAGACTGAACAAGAAAGCCAAAAGAAAGCATCCTCCGCAGTAAACTTGGAAA
TAAAAGCATCGCGAAAGAGCCAAGGCTGGGTGAGGCTGAAGGGTAGGTACGTCCAGCCGCAATCCACTAG
CGGAGAGGGCACAAAAGCGGGGCCCGGGCCCAGCCTCTGAGACCGCCCACAAGGGCCAGGCCTCCACCAC
CAAACCCGGGCTTTGCTGACTGCCGCTCGGGGTGGACCATGCCTAAAGATTCCGCCGCTAATATTTTTTT
TATTAACATTTTTTATTTTTTATTTCTGGACTGACTCCGATAAAAGGGTGTGGAAAGACAGCACCAACCG
CGCACTTCCCTTGACTTCTGCCCTCAATGCGTTGCCAACTTTGATTGAATGGGTGCTGCGGATGTGATTA
TGTAATACTGCCATTTCCAAGCAGTGTTTTTGGTAGGTTTTAATAAACAGACTTTTCAAATGACGGCAAT
ATAGAATCGTTAGATCCGTTGTTGATCTAAAAATATTTGCTTTATATTTTCATTAAATGACTTCTTTTAA
TATTTTATTCAAAATACTTATGAACTGCTGCAAAACGG
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:GTCCAAGAAAGGAGGGACCA; Reverse Primer - name:unspecified, sequence:CCGTTTTGCAGCAGTTCA. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13639 same embryo
 EMAGE:13640 same embryo
 EMAGE:13641 same embryo
 EMAGE:13637 same embryo
 EurExpress:euxassay_019559 same experiment
 MGI:4827340 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS