Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13691

Tgif2 TGFB-induced factor homeobox 2 ( MGI:1915299)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13691 EMAGE:13691 EMAGE:13691 EMAGE:13691 EMAGE:13691
"Pseudo-wholemount" of euxassay_019508. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019508_01 euxassay_019508_02 euxassay_019508_03 euxassay_019508_04
EMAGE:13691 EMAGE:13691 EMAGE:13691 EMAGE:13691 EMAGE:13691
euxassay_019508_05 euxassay_019508_06 euxassay_019508_07 euxassay_019508_08 euxassay_019508_09
EMAGE:13691 EMAGE:13691 EMAGE:13691 EMAGE:13691 EMAGE:13691
euxassay_019508_10 euxassay_019508_11 euxassay_019508_12 euxassay_019508_13 euxassay_019508_14
EMAGE:13691 EMAGE:13691 EMAGE:13691 EMAGE:13691 EMAGE:13691
euxassay_019508_15 euxassay_019508_16 euxassay_019508_17 euxassay_019508_18 euxassay_019508_19
EMAGE:13691 EMAGE:13691 EMAGE:13691 EMAGE:13691 EMAGE:13691
euxassay_019508_20 euxassay_019508_21 euxassay_019508_22 euxassay_019508_23 euxassay_019508_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13691Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13691_wholemount_strong.wlz
13691_wholemount_moderate.wlz
13691_wholemount_weak.wlz
13691_wholemount_possible.wlz
13691_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13691_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
forelimb digit 1 phalanx
moderate moderate
regionalmoderate expression: see section 02 03 23 24 weak expression: see section 04
forelimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 02 03 23 24 weak expression: see section 01
forelimb digit 3 phalanx
weak weak
regionalweak expression: see section 02 04 22 23 24
forelimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 22 23
forelimb digit 5 phalanx
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 22 23
vertebral axis musculature
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 21 22 23 24
thymus primordium
moderate moderate
regionalmoderate expression: see section 13 14 17 weak expression: see section 15
submandibular gland primordium
strong strong
regionalstrong expression: see section 08 09 10 11 18 19 20 21 22
thyroid gland
moderate moderate
regionalmoderate expression: see section 13 17 weak expression: see section 18
vibrissa
moderate moderate
regionalmoderate expression: see section 21 22 weak expression: see section 06 07 08 09 20 23
hypothalamus ventricular layer
strong strong
homogeneousstrong expression: see section 12 13 14 15
diencephalon lateral wall ventricular layer
strong strong
homogeneousstrong expression: see section 12 13 14 15
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 11 12 17 18
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22 23 24
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 17
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 15
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 05 06 07 13 15 17 18 21 22 23 moderate expression: see section 08 09 10 11 12 20
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 04 05 06 07 13 14 15 17 18 19 21 22 23 moderate expression: see section 08 09 10 11 12 20
pons ventricular layer
strong strong
regionalstrong expression: see section 07 13 14 17 18 moderate expression: see section 08 09 10
midbrain ventricular layer
strong strong
homogeneousstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 14 15 16
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 02 moderate expression: see section 03 weak expression: see section 24
cornea
weak weak
regionalweak expression: see section 02 03 04 05
cornea epithelium
weak weak
regionalweak expression: see section 24
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 weak expression: see section 04 24
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 09 10 17 18 19 20
esophagus
strong strong
regionalstrong expression: see section 14 15
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 16 17
lower jaw molar
moderate moderate
regionalmoderate expression: see section 21 weak expression: see section 08
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 16 17 18
upper jaw molar
moderate moderate
regionalmoderate expression: see section 07 09 20 21 weak expression: see section 08
metanephros
moderate moderate
regionalmoderate expression: see section 09 10 13 18 19 21 22 23 weak expression: see section 11 12 20
lung
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 12 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55202
Entity Detected:Tgif2, TGFB-induced factor homeobox 2 ( MGI:1915299)
Sequence:sense strand is shown

>T55202
AGGTGGTGGGTTATTTGCACCAGACGGTCATTTAGACACAGCAGAGACAGATGACAAAACCAGAGGCACA
CGTGTTTCTATTGTCGTGGTTAAGCTAGAGTGAAACAGCTCTGTTTTTCTCTCTGTTCTGAGTAACTCCC
CTCACCCCACCCCAGCGACCCCCACCCTGCACCACCTTTGTAGCTTGTTTCGGATTTATTCTGGAGCTTG
GCAAGAATGTCGTGTGCCAGCATCTACTTGGGAGGAGTGAGCCATCTGCTGGTCATTAGGCCCTTCGGAA
AGCTGCTTGTTCACAGAGGCAGCTGGAACCTTCCTGGAGGAGAGGCTGCTGAGGCTACCGACTGGCCCAC
CTCCCTTCAGGGTGGGATTGCAAGGGCCTGCCTAAATTTCCCGGGGAAACAGACCACACTTGGTCTTAAT
CTCTCCCCTTTTCCCGTTTACTTTGCTTAGTTTTCAGCAACAGTATACCCCATCTTTATATCCTAAGAAA
CACTAATCCTAGATTTGTATTAACCAAAATACTTGTGTTCTGAATAACCAGAAGATGTGAGGAGCCCTGA
CTGTGGTCTGAGGTTCACCCGGGTGTGAGCACAGACGGGGCTCTTGGATGTTGACTGGCTTGGAGTGCCT
GTTCCGAGGAAGGCAGAGACCACTCTGGCCTTTCCAGGGAGCCCCTGAGGCTTAGCAGGCTTCCATACCT
CTCCTGAGTGACTTCACCCATCCCTTGCTGTGCAAGTGGGCGCGAGAATGGCTATTTGTAAGGGGCTGCT
TCCCTGGGCTCTGCCTCATGCCTCCCTCTGGCTTCCTGTCCTGTAGGAGACCCAGCAGGCTCAACTCTCT
GTCACCCTGAGGCACTGCTGGGAAGGGAACATGGCTTCATTGACTTTGTGGTTTGCCCACTGCTACCCCA
CCTGTCTGTGAGACCCCATGATGGCTGTAGGATGCTAAGGCGGGGGTGATACTAGGATGAGGGATTTCTT
TTCCCCCCACAGTGCACTGAGCAAGGGAGGAGGGAGGGAGCCATGCTGCTGACATATTCTGGC
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:AGGTGGTGGGTTATTTGCAC; Reverse Primer - name:unspecified, sequence:GCCAGAATATGTCAGCAGCA. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13693 same embryo
 EMAGE:13694 same embryo
 EMAGE:13692 same embryo
 EMAGE:13690 same embryo
 EurExpress:euxassay_019508 same experiment
 MGI:4828683 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS