Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13694

Cbfa2t2 core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human) ( MGI:1333833)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13694 EMAGE:13694 EMAGE:13694 EMAGE:13694 EMAGE:13694
"Pseudo-wholemount" of euxassay_019496. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019496_01 euxassay_019496_02 euxassay_019496_03 euxassay_019496_04
EMAGE:13694 EMAGE:13694 EMAGE:13694 EMAGE:13694 EMAGE:13694
euxassay_019496_05 euxassay_019496_06 euxassay_019496_07 euxassay_019496_08 euxassay_019496_09
EMAGE:13694 EMAGE:13694 EMAGE:13694 EMAGE:13694 EMAGE:13694
euxassay_019496_10 euxassay_019496_11 euxassay_019496_12 euxassay_019496_13 euxassay_019496_14
EMAGE:13694 EMAGE:13694 EMAGE:13694 EMAGE:13694 EMAGE:13694
euxassay_019496_15 euxassay_019496_16 euxassay_019496_17 euxassay_019496_18 euxassay_019496_19
EMAGE:13694 EMAGE:13694 EMAGE:13694 EMAGE:13694 EMAGE:13694
euxassay_019496_20 euxassay_019496_21 euxassay_019496_22 euxassay_019496_23 euxassay_019496_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13694Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13694_wholemount_strong.wlz
13694_wholemount_moderate.wlz
13694_wholemount_weak.wlz
13694_wholemount_possible.wlz
13694_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13694_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thyroid gland
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 12 13
pituitary gland
moderate moderate
regionalmoderate expression: see section 11 13 14 15 weak expression: see section 12 16 17
vibrissa
moderate moderate
regionalmoderate expression: see section 21 22 weak expression: see section 06 07 08 09 20
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 11 moderate expression: see section 12 13 14 15
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 11 moderate expression: see section 12 13 14 15
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 11 12 17 18
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22 23 24
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 05 06 07 17 18 19 20 21 22 23 moderate expression: see section 04 08 09 10 11 12 13 14 15 16
midbrain ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 13 14 15 16 17 18 moderate expression: see section 08 12
neural retina
strong strong
regionalstrong expression: see section 01 02 03 weak expression: see section 04 23 24
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 08 09 10 13 17 18 19 20 moderate expression: see section 11 12 15 16
vomeronasal organ
strong strong
regionalstrong expression: see section 13
lung
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 13 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55020
Entity Detected:Cbfa2t2, core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human) ( MGI:1333833)
Sequence:sense strand is shown

>T55020
AGGCTGTGAGTGGCTTTCTCCTAAGGTGCTAAGTTATGTGCAGCCATGGGTCTCCATGGAATAACCTGTC
TGGCCCCCCGAGGTCTATCCAGGCATTGGCTGTCAGTCTTCTGTAATGTAGACTCCTTTACCCATTTGAT
CCCCAGGGAGTGCTTCAAATCTTGATGTCAGCTTTACCGTCATTTCTTGTCACCTTCTCAGAGAGAGTGA
AGACATTTTTTTCTGAGTGGTTCTGGAAACTATCTCAGCAGGTGTGTGAGGCCTCAACACAACTGCAAGT
GTGTGTTAGTGGTTCTCCCTAGAGCATAAGGAGTGAGCAGATGGCCTTCGTTCTGAAAACTGCAGACAGG
ATTGTGGGTTGAATAAACCTTTACAAATAGGACACGTCTTGGAGGCTTACTTCAGAACTGGACTGGAACC
AAGGTTTCCAGGCTCCTGGCTCAGGAGACTAAGCCAGTGTACTTTGATGAATGTTAGCTATTTGCAGAGA
ACTGGGTGGTGGCATGTTTGAACCAAATGTGAGAAAAGCCAGAAGGAACTGAACTGGCCATTGTGGACCA
GATGGCCAGCTGTGGAAGATCCTTGATCCAGCAGCTGCTTAGCAGACCCTGGCCACTCAAGTATATTCCT
TTAAAGCCAAAATGCTGACTACCTGCTTCTGCCTCATGTTGACACCCATTTCCAAAGATGATGGAGCCAG
TGTGAGCCAGGAGGAAGCTGAGATGGTGGCTGATAATTTACTCTACCATCTCCTTCCACAGCCCAAGAGG
TGGCACTTCCCGCTCAGACACCGTCTTATCAGGCCTCCAGCTGCCCAGTGTAAACTGTCAATGCTTATAC
CAAAAAGGGCATGTGCAGCTGGTGTCTGCCAGGGACAGCCCAGTCCCTGCCTTGTGGTTCCCAGGAAGAA
GCTGCAACAATTCAGTGAATGATTAAAGGGCTGTTTGATAATAAGGCCTTCGTTCCACTCCTGTGGCTTT
CCAAGTTCCTAATGAGGCTACAAAGGCTCCAT
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:AGGCTGTGAGTGGCTTTCTC; Reverse Primer - name:unspecified, sequence:ATGGAGCCTTTGTAGCCTCA. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13693 same embryo
 EMAGE:13692 same embryo
 EMAGE:13691 same embryo
 EMAGE:13690 same embryo
 EurExpress:euxassay_019496 same experiment
 MGI:4823650 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS