Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13695

Sox2 SRY-box containing gene 2 ( MGI:98364)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13695 EMAGE:13695 EMAGE:13695 EMAGE:13695 EMAGE:13695
"Pseudo-wholemount" of euxassay_019525. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019525_01 euxassay_019525_02 euxassay_019525_03 euxassay_019525_04
EMAGE:13695 EMAGE:13695 EMAGE:13695 EMAGE:13695 EMAGE:13695
euxassay_019525_05 euxassay_019525_06 euxassay_019525_07 euxassay_019525_08 euxassay_019525_09
EMAGE:13695 EMAGE:13695 EMAGE:13695 EMAGE:13695 EMAGE:13695
euxassay_019525_10 euxassay_019525_11 euxassay_019525_12 euxassay_019525_13 euxassay_019525_14
EMAGE:13695 EMAGE:13695 EMAGE:13695 EMAGE:13695 EMAGE:13695
euxassay_019525_15 euxassay_019525_16 euxassay_019525_17 euxassay_019525_18 euxassay_019525_19
EMAGE:13695 EMAGE:13695 EMAGE:13695 EMAGE:13695 EMAGE:13695
euxassay_019525_20 euxassay_019525_21 euxassay_019525_22 euxassay_019525_23 euxassay_019525_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13695Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13695_wholemount_strong.wlz
13695_wholemount_moderate.wlz
13695_wholemount_weak.wlz
13695_wholemount_possible.wlz
13695_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13695_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
adrenal medulla
weak weak
spottedweak expression: see section 09 10 11 18 19
pituitary gland
strong strong
regionalstrong expression: see section 13 moderate expression: see section 11 14 15 weak expression: see section 12 16
vibrissa
strong strong
regionalstrong expression: see section 04 05 06 07 08 18 19 20 21 22 23
hypothalamus mantle layer
strong strong
regionalstrong expression: see section 09 10 11 14 15 16
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 11 12 13
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 14 15 16 17 18 19
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 11 12 13
telencephalon mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
olfactory cortex ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 15 16
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 17 18 19 20 21 22 23 24
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 09 10 11 15 16
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 moderate expression: see section 17
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 09
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 10 11 12 13 14 15 16 18 19 20 21 22 23
pons mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 16 17 18 20
pons ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain mantle layer
strong strong
regionalstrong expression: see section 08 09 16 17 18 19 20
midbrain ventricular layer
strong strong
regionalstrong expression: see section 08 10 11 12 13 14 15 16 17 18
facial vii ganglion
weak weak
regionalweak expression: see section 05 06 21 22 23
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 07
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 09 18 weak expression: see section 05 06 07 08 19 21 22 23
ventral grey horn
strong strong
regionalstrong expression: see section 13 14 15 16 17
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 13 14 15 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 10 11 12 13 18 19
saccule
strong strong
regionalstrong expression: see section 04 05 06 07 09 18 19 22 23 24 moderate expression: see section 08 20 21
neural retina
strong strong
homogeneousstrong expression: see section 01 02 03 22 23 24
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
vomeronasal organ
strong strong
regionalstrong expression: see section 11 12 14 15
esophagus
strong strong
regionalstrong expression: see section 13 14 15
stomach
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 09 moderate expression: see section 08 10 11 12
hindgut
weak weak
regionalweak expression: see section 14 15
midgut
weak weak
regionalweak expression: see section 10 11 12 13 14 15 16 17
lower jaw incisor
strong strong
regionalstrong expression: see section 10 17 18 moderate expression: see section 11 15 weak expression: see section 16
oral epithelium
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
upper jaw incisor
strong strong
regionalstrong expression: see section 10 11 moderate expression: see section 15 weak expression: see section 16
bladder
weak weak
regionalweak expression: see section 14
testis
strong strong
regionalstrong expression: see section 07 09 21 moderate expression: see section 08 22 23 weak expression: see section 06 20
urethra of male
strong strong
regionalstrong expression: see section 14 moderate expression: see section 15
lung
strong strong
regionalstrong expression: see section 05 06
trachea
strong strong
regionalstrong expression: see section 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55185
Entity Detected:Sox2, SRY-box containing gene 2 ( MGI:98364)
Sequence:sense strand is shown

>T55185
CTGGACTGCGAACTGGAGAAGGGGAGAGATTTTCAAAGAGATACAAGGGAATTGGGAGGGGTGCAAAAAG
AGGAGAGTAGGAAAAATCTGATAATGCTCAAAAGGAAAAAAAATCTCCGCAGCGAAACGACAGCTGCGGA
AAAAAACCACCAATCCCATCCAAATTAACGCAAAAACCGTGATGCCGACTAGAAAACTTTTATGAGAGAT
CTTGGGACTTCTTTTTGGGGGACTATTTTTGTACAGAGAAAACCTGAGGGCGGCGGGGAGGGCGGGGGAA
TCGGACCATGTATAGATCTGGAGGAAAAAAACTACGCAAAACTTTTTTTTAAAGTTCTAGTGGTACGTTA
GGCGCTTCGCAGGGAGTTCGCAAAAGTCTTTACCAGTAATATTTAGAGCTAGACTCCGGGCGATGAAAAA
AAAGTTTTAATATTTGCAAGCAACTTTTGTACAGTATTTATCGAGATAAACATGGCAATCAAATGTCCAT
TGTTTATAAGCTGAGAATTTGCCAATATTTTTCGAGGAAAGGGTTCTTGCTGGGTTTTGATTCTGCAGCT
TAAATTTAGGACCGTTACAAACAAGGAAGGAGTTTATTCGGATTTGAACATTTTAGTTTTAAAATTGTAC
AAAAGGAAAACATGAGAGCAAGTACTGGCAAGACCGTTTTCGTGGTCTTGTTTAAGGCAAACGTTCTAGA
TTGTACTAAATTTTTAACTTACTGTTAAAGGCAAAAAAAAAATGTCCATGCAGGTTGATATCGTTGGTAA
TTTATAATAGCTTTTGTTCAATCCTACCCTTTCATTTTGTTCACATAAAAAATATGGAATTACTGTGTTT
GAAATATTTTCTTATGGTTTGTAATATTTCTGTAAATTGTGATATTTTAAGGTTTTTCCCCCCTTTTATT
TTCCGTAGTTGTATTTTAAAAGATTCGGCTCTGTTATTGGAATCAGGCTGCC
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:CTGGACTGCGAACTGGAGA; Reverse Primer - name:unspecified, sequence:GGCAGCCTGATTCCAATAAC. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4828390 same experiment
 EurExpress:euxassay_019525 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS