Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13763

Crebzf CREB/ATF bZIP transcription factor ( MGI:2675296)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13763 EMAGE:13763 EMAGE:13763 EMAGE:13763 EMAGE:13763
"Pseudo-wholemount" of euxassay_019497. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019497_01 euxassay_019497_02 euxassay_019497_03 euxassay_019497_04
EMAGE:13763 EMAGE:13763 EMAGE:13763 EMAGE:13763 EMAGE:13763
euxassay_019497_05 euxassay_019497_06 euxassay_019497_07 euxassay_019497_08 euxassay_019497_09
EMAGE:13763 EMAGE:13763 EMAGE:13763 EMAGE:13763 EMAGE:13763
euxassay_019497_10 euxassay_019497_11 euxassay_019497_12 euxassay_019497_13 euxassay_019497_14
EMAGE:13763 EMAGE:13763 EMAGE:13763 EMAGE:13763 EMAGE:13763
euxassay_019497_15 euxassay_019497_16 euxassay_019497_17 euxassay_019497_18 euxassay_019497_19
EMAGE:13763 EMAGE:13763 EMAGE:13763 EMAGE:13763 EMAGE:13763
euxassay_019497_20 euxassay_019497_21 euxassay_019497_22 euxassay_019497_23 euxassay_019497_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13763Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13763_wholemount_strong.wlz
13763_wholemount_moderate.wlz
13763_wholemount_weak.wlz
13763_wholemount_possible.wlz
13763_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13763_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 21 weak expression: see section 01 02 22 23
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 15
olfactory cortex ventricular layer
strong strong
regionalstrong expression: see section 17 moderate expression: see section 10 weak expression: see section 16
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 15 16 17 moderate expression: see section 05 14 18 19 21 22 23 weak expression: see section 04 20
rest of cerebellum ventricular layer
weak weak
regionalweak expression: see section 08 09 10 22 23
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 17 18 weak expression: see section 16 19
facial vii ganglion
strong strong
regionalstrong expression: see section 06 07 22 23
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 09 21
trigeminal v ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 18 19 21 22 23 24
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 09 21
dorsal root ganglion
strong strong
regionalstrong expression: see section 10 11 17 18 19 21 moderate expression: see section 16 weak expression: see section 12
neural retina
strong strong
regionalstrong expression: see section 01 moderate expression: see section 02 weak expression: see section 03 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55027
Entity Detected:Crebzf, CREB/ATF bZIP transcription factor ( MGI:2675296)
Sequence:sense strand is shown

>T55027
CCTCAGTGCTTTTCCTGCATTTGAAGTGTGGGCTTGGGGAAAATTAGTTTCTGAATTGGGATGTTTTGAA
ATTCCAAGTACAGAGTCTTAGGCTGTCATTTCATAAATGGCAGTTTGGAGAATTAGGAATTCTCAACAGT
GGAAGATCAGAGTGTCCTGTTTTTAAAGCTGCTTTCTTAGGTTCCTTATGTCTTATTAACTGTGTTTTTG
TTTCCATTTCATTGTTTTTTTCTAGTTTTGGTGACAGTGATTTTTGTCATTTTTTTTGCATCAACTCATG
GTCTTGTTTTTACATGGTAACTGCATGTATGTAGGATCTATCAGGGGCTTTAAATAAATTTTGCTCATAT
TTATGTGTAAGCACATTTTACTGTAAATGTTTGGGTTTAATTTACAGCAGTTGTTTATTTCAGTGTGTAG
TAAACAGTATCTAGAGTGTTCTGTTCACTACTTGTTAATTAAAAAAGTTATGATTAATATAAAACTGTTG
TCTTACTATTTTTAGAAAACTTTTGTGAATAATTAGTATTTTGATAGAGAGTTCTGAAATACAAAATAGA
TTGCTTTGAAAATTTCAGGTTTGGGTGTATTTACTGTGATGTTGAGAACAATTTAGTATTTGGGGAACTG
TTTCAGGTTTTATTCTTGATTTGTACCTGTGTAAAAATGATAGAAAACCTTAAAATGTAGCTTTTAAATA
CCTGTCTTCCTATGGTAGTTAATATTCATACATTAATTGACTAACACATATTGGCATAGTATTTCTATCA
TAGTAGCTTAAGTTTTTGTCCTTTTTTTAACCATACTTAAAAGTATGTTTGTTAAAAAATGTAGTCACAC
CTCTGATATATCCAACAAAGTATTCAAAATATTTTAAATATCTGTACATTTCATACTCGCTAAATTAATC
TCTTTCTCTTCTCTTTAAACAGCTTAGCAGTATCTGCAAAAACGAATCTTTTCCTACAACCTGTTAACTG
ACTGGACTGATGGTAACAGTAATTGTGGGAGCCATG
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:CCTCAGTGCTTTTCCTGCAT; Reverse Primer - name:unspecified, sequence:CATGGCTCCCACAATTACTG. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13764 same embryo
 EurExpress:euxassay_019497 same experiment
 MGI:4824048 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS