Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13777

Mir204 microRNA 204 ( MGI:2676879)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13777 EMAGE:13777 EMAGE:13777 EMAGE:13777 EMAGE:13777
"Pseudo-wholemount" of euxassay_019230. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019230_01 euxassay_019230_02 euxassay_019230_03 euxassay_019230_04
EMAGE:13777 EMAGE:13777 EMAGE:13777 EMAGE:13777 EMAGE:13777
euxassay_019230_05 euxassay_019230_06 euxassay_019230_07 euxassay_019230_08 euxassay_019230_09
EMAGE:13777 EMAGE:13777 EMAGE:13777 EMAGE:13777 EMAGE:13777
euxassay_019230_10 euxassay_019230_11 euxassay_019230_12 euxassay_019230_13 euxassay_019230_14
EMAGE:13777 EMAGE:13777 EMAGE:13777 EMAGE:13777 EMAGE:13777
euxassay_019230_15 euxassay_019230_16 euxassay_019230_17 euxassay_019230_18 euxassay_019230_19
EMAGE:13777 EMAGE:13777 EMAGE:13777 EMAGE:13777 EMAGE:13777
euxassay_019230_20 euxassay_019230_21 euxassay_019230_22 euxassay_019230_23 euxassay_019230_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13777Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13777_wholemount_strong.wlz
13777_wholemount_moderate.wlz
13777_wholemount_weak.wlz
13777_wholemount_possible.wlz
13777_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13777_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
weak weak
regionalweak expression: see section 08 09 10 17 18 19 20
epidermis
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vibrissa
moderate moderate
regionalmoderate expression: see section 02 03 04 05 21 22 23 weak expression: see section 06 18 19 20
lateral ventricle choroid plexus
strong strong
regionalstrong expression: see section 06 12 14 15 16 17 18 19 moderate expression: see section 05 07 08 09 13 weak expression: see section 10 11
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 13 14 15 16 17 18 19 20 21 22 23 moderate expression: see section 05 06 07 08 09 12 weak expression: see section 10 11
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 moderate expression: see section 02 20 21 22 23 24 weak expression: see section 03 04 05 06 07 08 19
cornea epithelium
moderate moderate
regionalmoderate expression: see section 01 02 03 21 22 weak expression: see section 23 24
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 10 11 14
pharynx
moderate moderate
regionalmoderate expression: see section 11 13 16 weak expression: see section 12 14 15
esophagus
moderate moderate
regionalmoderate expression: see section 15 16 weak expression: see section 14
stomach
weak weak
regionalweak expression: see section 05 06 07 10
oral epithelium
strong strong
regionalstrong expression: see section 05 06 07 08 09 17 18 19 moderate expression: see section 10 11 12 13 14 15 16 20
urethra of male
weak weak
regionalweak expression: see section 14 15
larynx
weak weak
regionalweak expression: see section 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70326
Entity Detected:Mir204, microRNA 204 ( MGI:2676879)
Sequence:sense strand is shown

>T70326
TTCCCTTTGTCATCCTATGCCT
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-204 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13779 same embryo
 EMAGE:13778 same embryo
 EurExpress:euxassay_019230 same experiment
 MGI:4826244 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS