Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13864

Mir300 microRNA 300 ( MGI:3619323)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13864 EMAGE:13864 EMAGE:13864 EMAGE:13864 EMAGE:13864
"Pseudo-wholemount" of euxassay_019266. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019266_01 euxassay_019266_02 euxassay_019266_03 euxassay_019266_04
EMAGE:13864 EMAGE:13864 EMAGE:13864 EMAGE:13864 EMAGE:13864
euxassay_019266_05 euxassay_019266_06 euxassay_019266_07 euxassay_019266_08 euxassay_019266_09
EMAGE:13864 EMAGE:13864 EMAGE:13864 EMAGE:13864 EMAGE:13864
euxassay_019266_10 euxassay_019266_11 euxassay_019266_12 euxassay_019266_13 euxassay_019266_14
EMAGE:13864 EMAGE:13864 EMAGE:13864 EMAGE:13864 EMAGE:13864
euxassay_019266_15 euxassay_019266_16 euxassay_019266_17 euxassay_019266_18 euxassay_019266_19
EMAGE:13864 EMAGE:13864 EMAGE:13864 EMAGE:13864 EMAGE:13864
euxassay_019266_20 euxassay_019266_21 euxassay_019266_22 euxassay_019266_23 euxassay_019266_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13864Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13864_wholemount_strong.wlz
13864_wholemount_moderate.wlz
13864_wholemount_weak.wlz
13864_wholemount_possible.wlz
13864_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13864_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 08 weak expression: see section 01 02 03 04 05 06 07 09 20 21 22 23 24
humerus
moderate moderate
regionalmoderate expression: see section 01 02 03 04 24
hindlimb digit 2 metatarsal
moderate moderate
regionalmoderate expression: see section 05
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 06
hindlimb digit 3 metatarsal
moderate moderate
regionalmoderate expression: see section 05
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 06
hindlimb digit 4 phalanx
weak weak
regionalweak expression: see section 06
fibula
moderate moderate
regionalmoderate expression: see section 02 03 04 weak expression: see section 01
tibia
moderate moderate
regionalmoderate expression: see section 02 03
femur
moderate moderate
regionalmoderate expression: see section 02 03 04 06 07 24
submandibular gland primordium
weak weak
regionalweak expression: see section 08 09 10 19 20 21
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 17 18
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 22 23
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 08 20 weak expression: see section 07
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 19 20 22 23 24 weak expression: see section 21
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 09 19
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11 18 19
otic capsule
moderate moderate
regionalmoderate expression: see section 10 11 18 19 20 weak expression: see section 07 08 09
neural retina
weak weak
regionalweak expression: see section 01 02 03 04
mandible
moderate moderate
regionalmoderate expression: see section 24 weak expression: see section 03 04 05 06 07 22 23
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 18 19 20 21 22 23 24 weak expression: see section 17
axial skeleton
moderate moderate
regionalmoderate expression: see section 08 12 weak expression: see section 09 10 11 13 16 17 18 19
basioccipital bone
moderate moderate
regionalmoderate expression: see section 10 11 12 16 17 weak expression: see section 13 14 15
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 08
exoccipital bone
moderate moderate
regionalmoderate expression: see section 05 06 07 08 20 21 22
temporal bone petrous part
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 21 22 23 24
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 12 16 20 21 22 23 24 weak expression: see section 13 14 15
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
clavicle
moderate moderate
regionalmoderate expression: see section 18 19 weak expression: see section 10 11 20
scapula
moderate moderate
regionalmoderate expression: see section 03 04 24
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 07 08 11 12 19 20 22 23 weak expression: see section 09 10 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70382
Entity Detected:Mir300, microRNA 300 ( MGI:3619323)
Sequence:sense strand is shown

>T70382
TATGCAAGGGCAAGCTCTCTTC
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-300 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13865 same embryo
 EurExpress:euxassay_019266 same experiment
 MGI:4826266 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS